G155235


Basic Information

Item Value
gene id G155235
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 6722344 ~ 6722557 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU176261
GTCCATATCATGTTTATCCTCCTCAGATGCCATCAAGCAACGGTTTGTTTATGCAAATAAGACGAACTTTAAACAGGGATTTAACTATTTTAAAGGAAACCGTTCGTCTTTCACATTCACTCCCGGTTGCTTACCGGGTCTTATCTTTAGGCTTACTGTAAAAAGAAAACAAGCAGCAAGAGAAACACATCATTCAACCGCGCAATCACATAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU176261 True 214 lncRNA 0.39 1 6722344 6722557

Neighbor

gene id symbol gene type direction distance location
CI01000029_06494856_06495812 NA coding upstream 226497 6494391 ~ 6495847 (+)
CI01000029_06453008_06476863 NA coding upstream 245254 6453008 ~ 6477090 (+)
CI01000029_06443365_06447942 CRNKL1 coding upstream 274402 6443365 ~ 6447942 (+)
CI01000029_06347167_06348123 NA coding upstream 374175 6346660 ~ 6348169 (+)
CI01000029_06305668_06307332 NKX2.4B coding upstream 414669 6305245 ~ 6307675 (+)
CI01000029_06724205_06734079 HMBOX1B, HMBOX1 coding downstream 1648 6724205 ~ 6735582 (+)
CI01000029_06775631_06791278 INTS9 coding downstream 53074 6775631 ~ 6791346 (+)
CI01000029_06824397_06831521 CUNH14ORF169 coding downstream 101072 6823629 ~ 6832671 (+)
CI01000029_06834812_06849277 CPSF2 coding downstream 111020 6833577 ~ 6849518 (+)
CI01000029_06865685_06903896 SLC24A4, SLC24A4B coding downstream 143128 6865685 ~ 6903896 (+)
G155248 NA non-coding upstream 160 6721963 ~ 6722184 (+)
G155236 NA non-coding upstream 32407 6689281 ~ 6689937 (+)
G155218 NA non-coding upstream 33266 6688755 ~ 6689078 (+)
G155194 NA non-coding upstream 41376 6672937 ~ 6680968 (+)
G155193 NA non-coding upstream 115239 6603095 ~ 6607105 (+)
G155249 NA non-coding downstream 22275 6744832 ~ 6747562 (+)
G155253 NA non-coding downstream 28730 6751287 ~ 6751778 (+)
G155274 NA non-coding downstream 129919 6852476 ~ 6852878 (+)
CI01000029_06906861_06907157 NA non-coding downstream 183818 6905834 ~ 6908633 (+)
G155357 NA non-coding downstream 278882 7001439 ~ 7001888 (+)
G155083 NA other upstream 232050 6431535 ~ 6490294 (+)
G155079 NA other upstream 433946 6282685 ~ 6288398 (+)
CI01000029_05461497_05468985 BATF other upstream 1251998 5461497 ~ 5470346 (+)
G154587 NA other upstream 1450809 5271020 ~ 5271535 (+)
G153790 NA other upstream 1982237 4733589 ~ 4740107 (+)
G155522 NA other downstream 912276 7634833 ~ 7637834 (+)
G155627 NA other downstream 1208923 7931480 ~ 7932177 (+)
G156007 NA other downstream 2242261 8964818 ~ 9064541 (+)

Expression


Co-expression Network