G167885


Basic Information

Item Value
gene id G167885
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000033
NCBI id null
chromosome length 1934898
location 519344 ~ 519553 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU190727
TTAAAATGATTCATTTCGGTCTTAATGGAAGTTCCCTAAACAAGAAGTGCCACCTATAATTCAAAAACACAGTAGGTTCATCAGGAATAAGGTGGATAGAACCTTTTCCTCTAAGTGGTCGTTTTCACAGAATTCTTTTTTTCCTTTCCACTGTGATACTTTTCCATTGTTTTCAATGTAAACACGCACTCTTTCATCGTTGCGCTTAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU190727 True 210 lncRNA 0.36 1 519344 519553

Neighbor

gene id symbol gene type direction distance location
CI01000033_00497624_00498442 NA coding upstream 20865 497624 ~ 498479 (+)
CI01000033_00425156_00470606 DNM2A, DNM2 coding upstream 48668 425156 ~ 470676 (+)
CI01000033_00263817_00267075 PMP22A coding upstream 251916 263766 ~ 267428 (+)
CI01000033_00227674_00228681 CDC42EP4A coding upstream 289994 227674 ~ 229350 (+)
CI01000033_00131331_00201065 SDK2, SDK2B coding upstream 318025 131331 ~ 201319 (+)
CI01000033_00523275_00559791 PPAP2D coding downstream 3722 523275 ~ 559791 (+)
CI01000033_00702445_00711580 NA coding downstream 182710 702263 ~ 711893 (+)
CI01000033_00715688_00732487 NA coding downstream 195543 715096 ~ 732713 (+)
CI01000033_00745197_00770385 NA coding downstream 225576 745129 ~ 770734 (+)
CI01000033_00932452_00979938 TBCD coding downstream 412899 932452 ~ 979938 (+)
G167883 NA non-coding upstream 823 518320 ~ 518521 (+)
G167744 NA non-coding upstream 18592 498986 ~ 500752 (+)
G167851 NA non-coding upstream 161185 357765 ~ 358159 (+)
G167837 NA non-coding upstream 198829 320132 ~ 320515 (+)
G167749 NA non-coding upstream 220233 298497 ~ 299111 (+)
G167899 NA non-coding downstream 73090 592643 ~ 593041 (+)
G167905 NA non-coding downstream 80164 599717 ~ 599952 (+)
G167913 NA non-coding downstream 92714 612267 ~ 612601 (+)
G167915 NA non-coding downstream 94866 614419 ~ 614755 (+)
G167925 NA non-coding downstream 127753 647306 ~ 650179 (+)

Expression


Co-expression Network