G172366


Basic Information

Item Value
gene id G172366
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 4046675 ~ 4047140 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU195817
GCACGAGAGAGACAGATAAAGAGAGAGAAAAGCAGAATGAAAGTATAAAAAGAAACCAGACTGGCTTTCGGGAACGCTGCCGGGTTTGGCTCTTCAGCCATCTATTTGACTTTCCTCCTAGCCATCTCTTTTCCTTTTCCTTCTCTCACTAAAAAACACATATATAGTCAAATACCATTGAAAAAATTCGTCCACTCGGATATCATCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU195817 True 208 lncRNA 0.41 2 4046675 4047140

Neighbor

gene id symbol gene type direction distance location
CI01000034_04019323_04045212 MRC2 coding downstream 1463 4019240 ~ 4045212 (-)
CI01000034_03956763_03960891 NA coding downstream 85784 3956763 ~ 3960891 (-)
CI01000034_03915853_03921269 ASB16 coding downstream 125406 3915751 ~ 3921269 (-)
CI01000034_03911480_03913846 TMUB2 coding downstream 132829 3911075 ~ 3913846 (-)
CI01000034_03803160_03827982 NGFRA coding downstream 218693 3802832 ~ 3827982 (-)
CI01000034_04065210_04081772 TLK2 coding upstream 17379 4064519 ~ 4081772 (-)
CI01000034_04087755_04088054 NA coding upstream 40423 4087563 ~ 4088764 (-)
CI01000034_04090497_04095923 NA coding upstream 43092 4090232 ~ 4095923 (-)
CI01000034_04101415_04114654 ITGB3A coding upstream 53482 4100622 ~ 4114654 (-)
CI01000034_04154954_04164874 NA coding upstream 107511 4154651 ~ 4164874 (-)
G172298 NA non-coding downstream 29981 4012500 ~ 4016694 (-)
G172316 NA non-coding downstream 109209 3934545 ~ 3937466 (-)
G172303 NA non-coding downstream 114058 3931628 ~ 3932617 (-)
G172312 NA non-coding downstream 115390 3928905 ~ 3931285 (-)
G172314 NA non-coding downstream 172293 3870728 ~ 3874382 (-)
G172297 NA non-coding upstream 16752 4063892 ~ 4064161 (-)
G172378 NA non-coding upstream 69343 4116483 ~ 4116934 (-)
G172379 NA non-coding upstream 69839 4116979 ~ 4117214 (-)
G172384 NA non-coding upstream 77979 4125119 ~ 4126846 (-)
G172398 NA non-coding upstream 154673 4201813 ~ 4202052 (-)
G172151 NA other downstream 648862 3391144 ~ 3451802 (-)
G172016 NA other downstream 810060 3234963 ~ 3236615 (-)
CI01000034_02510595_02511512 NA other downstream 1535154 2510061 ~ 2511521 (-)
G171835 NA other downstream 1600382 2441821 ~ 2446293 (-)
G171755 NA other downstream 2180302 1864118 ~ 1866373 (-)
CI01000034_04165535_04172272 KCTD13 other upstream 119359 4165373 ~ 4172272 (-)
CI01000034_04216451_04218876 NA other upstream 169072 4216212 ~ 4221881 (-)
G172593 NA other upstream 945820 4992960 ~ 4994943 (-)
G172800 NA other upstream 1741892 5789032 ~ 5789738 (-)
CI01000034_05795972_05811363 NA other upstream 1750430 5795835 ~ 5811781 (-)

Expression


Co-expression Network