G178207


Basic Information

Item Value
gene id G178207
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 732689 ~ 733081 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU202394
AGAAAGAGAGAGAGTTGCTGTGTATCCTGAATGATTTATTTGCTGGCCTTCACAGCTATGAGGCTACAGCTCTGATTCAAAGCTCCTCCGTAACACTGACAAATGACATATATTCCTGGCTGACATGAATACTGTACTGAATATGACCTGCTCAATGGGGACAACCATCCCGGCCCTCTCTATTTTGAAGTTCCTCAGAGGGCATCGGGACACAGAAGTGAAGGGCTTGAGATAGAGATCTGTGACATTCATCCTCAGGTGGTTTCTAGTACATATTTAGCACTGTAAAGCTTTTGCAATGGATCTTGCATAATCGTGTCACCCCCAGAGGTGCAGTAACTCACACATAATGTTAGTACAATAGACCTACTAAAACATCCATTTACATGTGTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU202394 True 393 lncRNA 0.43 1 732689 733081

Neighbor

gene id symbol gene type direction distance location
CI01000039_00709842_00711526 NA coding upstream 19753 708970 ~ 712936 (+)
CI01000039_00521668_00538621 NA coding upstream 192952 521580 ~ 539737 (+)
CI01000039_00456713_00492445 NA coding upstream 238508 455981 ~ 494181 (+)
CI01000039_00438534_00441842 NA coding upstream 290459 437469 ~ 442230 (+)
CI01000039_00430014_00430412 NA coding upstream 302152 429442 ~ 430537 (+)
CI01000039_00753373_00753959 NA coding downstream 20092 753173 ~ 754791 (+)
CI01000039_00918013_00930418 NA coding downstream 183315 916396 ~ 930664 (+)
CI01000039_00945143_00973554 NA coding downstream 211895 944976 ~ 974142 (+)
CI01000039_00982878_00985676 NA coding downstream 249669 982750 ~ 985752 (+)
CI01000039_00995716_00997695 NA coding downstream 262588 995669 ~ 997834 (+)
G178206 NA non-coding upstream 795 731340 ~ 731894 (+)
G178172 NA non-coding upstream 50838 681641 ~ 681851 (+)
G178137 NA non-coding upstream 90923 641550 ~ 641766 (+)
G178115 NA non-coding upstream 116542 615853 ~ 616147 (+)
G178347 NA non-coding downstream 128365 861446 ~ 861689 (+)
G178354 NA non-coding downstream 140182 873263 ~ 874138 (+)
G178423 NA non-coding downstream 212872 966676 ~ 982406 (+)
G178432 NA non-coding downstream 261838 994919 ~ 996212 (+)
G178436 NA non-coding downstream 372983 1106064 ~ 1106574 (+)
G179528 NA other downstream 1764593 2497674 ~ 2498619 (+)
G179798 NA other downstream 2396491 3129572 ~ 3132184 (+)
G179903 NA other downstream 2690956 3424037 ~ 3425555 (+)
CI01000039_04048342_04049635 NA other downstream 3315212 4048079 ~ 4049972 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G48656 NA non-coding CI01000006 null 12957587 ~ 12957874 (+)
rainbow trout (Oncorhynchus mykiss) G49524 NA non-coding NC_048565.1 CM023219.2 45243773 ~ 45243993 (-)
tiger barb (Puntius tetrazona) G37490 NA non-coding NC_056703.1 CM032072.1 18197203 ~ 18197542 (+)