G180106


Basic Information

Item Value
gene id G180106
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000039
NCBI id null
chromosome length 8355537
location 3965654 ~ 3965925 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU204497
TTGTGCATCATCTTTAGAAGAGGCTTCCTTCTGGGACGACAGCCATGCAGACCAATTTGATGCAGTGTGCGGCGTATGGTCTGAGCACTGACAGGCTGACCCCCCACCCCTTCAACCTCTGCAGCAATGCTGGCAGCACTCATACGTCTATTTCCCAAACACAACCTCTGGATATGACGCTGAGCACGTGCACTCAACTTCTTTGGTCAACCATGGCGAGGCCTGTTCTGAGTGGAACCTGTCCTGTTAAACCGCTGTATGGTCTTGGCCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU204497 True 272 lncRNA 0.53 1 3965654 3965925

Neighbor

gene id symbol gene type direction distance location
CI01000039_03932128_03934945 NA coding upstream 29719 3931527 ~ 3935935 (+)
CI01000039_03782970_03797693 RTKN coding upstream 167148 3782970 ~ 3798506 (+)
CI01000039_03747667_03748958 NA coding upstream 216367 3747315 ~ 3749287 (+)
CI01000039_03694332_03696941 NA coding upstream 268584 3694332 ~ 3697070 (+)
CI01000039_03684191_03691901 MCCC2, MCCC2.S coding upstream 273722 3684191 ~ 3691932 (+)
CI01000039_04011515_04015116 GRSF1 coding downstream 45524 4011449 ~ 4015116 (+)
CI01000039_04017602_04018203 GRSF1 coding downstream 51677 4017602 ~ 4018468 (+)
CI01000039_04048342_04049635 NA coding downstream 82154 4048079 ~ 4049972 (+)
CI01000039_04058417_04059141 NA coding downstream 92418 4058343 ~ 4059526 (+)
CI01000039_04062068_04062375 NA coding downstream 96078 4062003 ~ 4062961 (+)
G180103 NA non-coding upstream 13101 3952204 ~ 3952553 (+)
G180098 NA non-coding upstream 28769 3936659 ~ 3936885 (+)
G180093 NA non-coding upstream 48942 3915414 ~ 3916712 (+)
G180067 NA non-coding upstream 86615 3878516 ~ 3879039 (+)
G179991 NA non-coding upstream 120110 3844458 ~ 3845544 (+)
G180107 NA non-coding downstream 1758 3967683 ~ 3968006 (+)
G180108 NA non-coding downstream 5534 3971459 ~ 3971664 (+)
G180109 NA non-coding downstream 7984 3973909 ~ 3974145 (+)
G180111 NA non-coding downstream 9133 3975058 ~ 3975700 (+)
G179903 NA other upstream 540099 3424037 ~ 3425555 (+)
G179798 NA other upstream 833470 3129572 ~ 3132184 (+)
G179528 NA other upstream 1467035 2497674 ~ 2498619 (+)
G178423 NA other upstream 2979902 966676 ~ 982406 (+)
G180149 NA other downstream 108951 4079419 ~ 4079563 (+)
G180156 NA other downstream 125073 4090998 ~ 4091608 (+)
CI01000039_04223888_04224220 EMC6.S, EMC6, EMC6.L other downstream 257654 4223868 ~ 4224657 (+)
CI01000039_04829464_04847182 ZFR other downstream 878257 4829413 ~ 4848563 (+)

Expression


Co-expression Network