G187873


Basic Information

Item Value
gene id G187873
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 6046401 ~ 6046651 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU213349
CATTTCCACTTTCTTATTTCCTATGTATGCGTGAATTGTATGTTTGTATGTGTTTAGTCTAGCTATGTGTTCGTGATTTAGTTAAATAAAACTTGTATGCACATTCTTGCGAGTTTATTCTGATCTGCTTATTAACCAATGTCACTGATAACGATTAAGATCACAGCTACATGATAAGAAAGAGTTATTTATTTGGTGGCCACGGAAAATATCCTTTCTGAAGAGTTAATGATCAATACTGAGTTTTCGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU213349 True 251 lncRNA 0.33 1 6046401 6046651

Neighbor

gene id symbol gene type direction distance location
CI01000040_05977984_05981590 NA coding downstream 63473 5977580 ~ 5982928 (-)
CI01000040_05916108_05961765 WWC1 coding downstream 84373 5915872 ~ 5962028 (-)
CI01000040_05909175_05910454 CNOT8, CNOT7 coding downstream 135947 5908714 ~ 5910454 (-)
CI01000040_05865054_05868808 MRPL22 coding downstream 177593 5864997 ~ 5868808 (-)
CI01000040_05761106_05766999 NA coding downstream 279402 5759957 ~ 5766999 (-)
CI01000040_06066026_06096365 DBN1 coding upstream 19283 6065934 ~ 6096365 (-)
CI01000040_06134860_06137499 NA coding upstream 87724 6134375 ~ 6137650 (-)
CI01000040_06149714_06150666 NA coding upstream 102664 6149315 ~ 6151064 (-)
CI01000040_06159849_06174033 NA coding upstream 112909 6159560 ~ 6174033 (-)
CI01000040_06187028_06199992 NA coding upstream 140024 6186675 ~ 6199992 (-)
G187869 NA non-coding downstream 4024 6042110 ~ 6042377 (-)
G187867 NA non-coding downstream 6013 6040081 ~ 6040388 (-)
G187865 NA non-coding downstream 8642 6037547 ~ 6037759 (-)
G187853 NA non-coding downstream 43241 6001574 ~ 6003160 (-)
G187836 NA non-coding downstream 185063 5861114 ~ 5861338 (-)
G187898 NA non-coding upstream 175428 6222079 ~ 6222306 (-)
G187918 NA non-coding upstream 225253 6271904 ~ 6272134 (-)
G187955 NA non-coding upstream 233274 6279925 ~ 6280173 (-)
G187981 NA non-coding upstream 262666 6309317 ~ 6309537 (-)
G187982 NA non-coding upstream 263084 6309735 ~ 6309943 (-)
G187348 NA other downstream 480848 5562655 ~ 5565553 (-)
G187207 NA other downstream 759483 5264193 ~ 5286918 (-)
G185681 NA other downstream 2701521 3344475 ~ 3344880 (-)
G185593 NA other downstream 3053718 2992188 ~ 2992683 (-)
CI01000040_02595281_02596387 FGF1B other downstream 3449977 2594895 ~ 2596728 (-)
G188009 NA other upstream 294876 6341527 ~ 6342701 (-)
CI01000040_06423141_06425495 RBMX2 other upstream 376202 6422853 ~ 6425495 (-)
G188226 NA other upstream 656550 6703201 ~ 6783675 (-)

Expression


Co-expression Network