G187743


Basic Information

Item Value
gene id G187743
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000040
NCBI id null
chromosome length 6879596
location 6553106 ~ 6553373 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU213206
CACACTTTAATCAGCTAATTAACTCAAAACACCTGCAAAGGCTTTTAAATGGTCTCTCAGTCTAGTTCTGTAGGCTACACAATCATGGGGAAGACTGCTGACTTGACAGTTGTCCAAAAGACGACCATTGACACCTTGCACAAGGAGGGCAAGACACAAAAGGTCATTGCAAAAGAGGCTGGCTGTTCACAGAGCTCTGTGTCCAAGCACATTAATAGAGAGGCGAAGGGAAGGAAAAGATGTGGTAGAAAAAAGTGTACAAGCAATA

Function

NR:

description
small nuclear ribonucleoprotein E

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU213206 True 268 lncRNA 0.43 1 6553106 6553373

Neighbor

gene id symbol gene type direction distance location
CI01000040_06514889_06518461 NA coding upstream 34376 6514889 ~ 6518730 (+)
CI01000040_06461477_06485579 POF1B coding upstream 66942 6461385 ~ 6486164 (+)
CI01000040_06433752_06454833 SLC25A14 coding upstream 98228 6433752 ~ 6454878 (+)
CI01000040_06432700_06433513 NA coding upstream 119455 6432383 ~ 6433651 (+)
CI01000040_06377128_06414371 SIAH2L, SIAH2 coding upstream 138735 6377128 ~ 6414371 (+)
CI01000040_06707788_06710457 NA coding downstream 154415 6707788 ~ 6711590 (+)
CI01000040_06787406_06804047 NA coding downstream 234033 6787406 ~ 6804084 (+)
CI01000040_06833701_06848731 NA coding downstream 279614 6832987 ~ 6849135 (+)
G187718 NA non-coding upstream 48048 6504387 ~ 6505058 (+)
G187716 NA non-coding upstream 51558 6501226 ~ 6501548 (+)
G187507 NA non-coding upstream 129172 6420996 ~ 6423934 (+)
G187702 NA non-coding upstream 249124 6303694 ~ 6303982 (+)
G187692 NA non-coding upstream 273244 6279609 ~ 6279862 (+)
G187788 NA non-coding downstream 86020 6639393 ~ 6639610 (+)
G188102 NA non-coding downstream 95734 6649107 ~ 6649339 (+)
G188156 NA non-coding downstream 133937 6687310 ~ 6687582 (+)
G188152 NA non-coding downstream 207461 6760834 ~ 6764506 (+)
G188192 NA non-coding downstream 257012 6810385 ~ 6810799 (+)
G187510 NA other upstream 581374 5969045 ~ 5971732 (+)
G185947 NA other upstream 2578983 3973765 ~ 3974123 (+)
G185884 NA other upstream 2813825 3738987 ~ 3739281 (+)
G185296 NA other upstream 3219123 3333578 ~ 3333983 (+)
G184003 NA other upstream 5316617 1230292 ~ 1236489 (+)
G188149 NA other downstream 255318 6808691 ~ 6809130 (+)

Expression


Co-expression Network