G197125


Basic Information

Item Value
gene id G197125
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 4382278 ~ 4382492 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU223794
CAAACTATCACTATAGCATTTACTCTGAGGTAAGACTACAATAGAATTATTTGAGGAAAGACATACAAGAGAATGTGGGAAAACAGAACTTTTGAGCTGAACAGTTGATATGCTTGACAGAGTTCTGAGATTCAAGTTAACATAGGCAAATACTGACATTTAAAGGGTTAGTTCACCCAAAAATGAAATTTCTGTCATTAATTACTCACCCTCAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU223794 True 215 lncRNA 0.34 1 4382278 4382492

Neighbor

gene id symbol gene type direction distance location
CI01000046_04319601_04326459 NA coding upstream 55746 4319601 ~ 4326532 (+)
CI01000046_04308380_04317709 GRAP, GRAPA coding upstream 64308 4308380 ~ 4317970 (+)
CI01000046_04274035_04275654 B9D1 coding upstream 106516 4273852 ~ 4275762 (+)
CI01000046_04098044_04120141 LLGL1 coding upstream 261926 4096231 ~ 4120352 (+)
CI01000046_04081845_04083512 NA coding upstream 298743 4081721 ~ 4083535 (+)
CI01000046_04478947_04510165 ARHGAP23A coding downstream 96455 4478947 ~ 4511125 (+)
CI01000046_04532653_04542785 PLCD3, PLCD3A coding downstream 150161 4532653 ~ 4542785 (+)
CI01000046_04545960_04557955 NMT1A, NMT1 coding downstream 163468 4545960 ~ 4558453 (+)
CI01000046_04563154_04565515 NA coding downstream 180595 4563087 ~ 4565727 (+)
CI01000046_04579543_04581492 NA coding downstream 196789 4579281 ~ 4581540 (+)
G197124 NA non-coding upstream 2490 4374282 ~ 4379788 (+)
G197119 NA non-coding upstream 13076 4368956 ~ 4369202 (+)
G197115 NA non-coding upstream 21778 4360222 ~ 4360500 (+)
G197114 NA non-coding upstream 22591 4359289 ~ 4359687 (+)
G197113 NA non-coding upstream 23478 4358500 ~ 4358800 (+)
G197130 NA non-coding downstream 15026 4397518 ~ 4397830 (+)
G197135 NA non-coding downstream 30370 4412862 ~ 4413349 (+)
G197136 NA non-coding downstream 39244 4421736 ~ 4421959 (+)
G197140 NA non-coding downstream 53386 4435878 ~ 4436252 (+)
G196889 NA non-coding downstream 54745 4437237 ~ 4443882 (+)
G197121 NA other upstream 10848 4371011 ~ 4371430 (+)
G197055 NA other upstream 232498 4149423 ~ 4149780 (+)
CI01000046_03943890_03945302 ATP5J2 other upstream 436778 3943794 ~ 3945500 (+)
G196936 NA other upstream 1188007 3186995 ~ 3194271 (+)
CI01000046_02451052_02454565 MAFK other upstream 1924998 2442395 ~ 2457280 (+)
G196869 NA other downstream 33038 4415530 ~ 4421687 (+)
G197352 NA other downstream 891890 5259318 ~ 5276453 (+)
G197528 NA other downstream 1343629 5726121 ~ 5742684 (+)
CI01000046_06808895_06820945 GSPT1, ERF3B, GSPT1L other downstream 2437446 6808507 ~ 6821543 (+)

Expression


Co-expression Network