G198545



Basic Information


Item Value
gene id G198545
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000046
NCBI id null
chromosome length 7063170
location 4385144 ~ 4385485 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU225355
TTTACTCACCCGTTCGAAACCAGTATGTTTTCTTTTCTTCTGTGAAGAAGATTCTGAGGAACATTGGGAACCAGTAGAACTAATTTTGGTGCCAACTGACTTCCATTGTATGAAAAATACACTGATACGTTTTTCAAAATATGTCCCACAAAAAAATTAGTCATACAACTTTGAAATAAGATGAGGGCATCAGAATTTTTATTTTTAATGAACTATCCCTTTAACATGGACCCTCAAAAGAGCACATCCTGTTTTACCGTTTAGAGAAATAACTACTACTAATAAATATTATATTACTAAATATTTCTTACACACACACACATATATATATTTATATAAAGC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU225355 True 342 lncRNA 0.31 1 4385144 4385485

Neighbor


gene id symbol gene type direction distance location
CI01000046_04374630_04379582 NA coding downstream 5556 4374510 ~ 4379588 (-)
CI01000046_04352237_04355463 ALDOAA, ALDOA, ALD, ALDOAB coding downstream 29653 4351849 ~ 4355491 (-)
CI01000046_04345411_04345806 NA coding downstream 39338 4345202 ~ 4345806 (-)
CI01000046_04336982_04343632 NA coding downstream 41090 4336705 ~ 4344054 (-)
CI01000046_04329752_04335164 PRPSAP2 coding downstream 49980 4328884 ~ 4335164 (-)
CI01000046_04415076_04421680 NA coding upstream 29285 4414770 ~ 4421690 (-)
CI01000046_04440916_04442340 NA coding upstream 55073 4440558 ~ 4442359 (-)
CI01000046_04640883_04644188 TMEM98 coding upstream 253748 4639233 ~ 4644521 (-)
CI01000046_04647083_04657110 NA coding upstream 261025 4646505 ~ 4657274 (-)
CI01000046_04685212_04689255 NA coding upstream 299700 4685185 ~ 4689375 (-)
G198544 NA non-coding downstream 649 4383983 ~ 4384495 (-)
G198538 NA non-coding downstream 13781 4370741 ~ 4371363 (-)
G198535 NA non-coding downstream 20651 4364201 ~ 4364493 (-)
G198533 NA non-coding downstream 25175 4359726 ~ 4359969 (-)
G198532 NA non-coding downstream 26049 4358799 ~ 4359095 (-)
G198548 NA non-coding upstream 2424 4387909 ~ 4388141 (-)
G198550 NA non-coding upstream 4699 4390184 ~ 4390540 (-)
G198555 NA non-coding upstream 9689 4395174 ~ 4395541 (-)
G198582 NA non-coding upstream 21544 4407029 ~ 4407241 (-)
G198585 NA non-coding upstream 36609 4422094 ~ 4422298 (-)
G198265 NA other downstream 585043 3665243 ~ 3800101 (-)
CI01000046_02866255_02867695 MRM2, FTSJ2 other downstream 1517350 2866070 ~ 2867794 (-)
G196463 NA other downstream 2216500 2168266 ~ 2168644 (-)
CI01000046_00777923_00780186 RPC11, POLR3K, POLR3K.S other downstream 3604851 774434 ~ 780293 (-)
G195098 NA other downstream 3709016 670736 ~ 676128 (-)
G199054 NA other upstream 1711874 6097359 ~ 6097674 (-)
G199014 NA other upstream 1978693 6364178 ~ 6375406 (-)
G199130 NA other upstream 2192495 6577980 ~ 6594210 (-)
G199181 NA other upstream 2441200 6826685 ~ 6830453 (-)

Expression



Co-expression Network