G211822


Basic Information

Item Value
gene id G211822
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 9600991 ~ 9601444 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU240291
CTCATGTAGTTCCACACCTGTAAGACCTTCGTTCATCTTCAGAACACAAATTAAGATATTTTTGATGTCTTTTTATCCTCCATAGACAGCAATTTAACAGAAACGTACTGAAGACATCATTAAAACAGTCCATGTGACTGCAGTGGTCACGTGGACAAAACAAAACAAAAATAACGATTTTCTTCAACAATATCTTCTCTTCTGTGTCATTCTCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU240291 True 215 lncRNA 0.36 2 9600991 9601444

Neighbor

gene id symbol gene type direction distance location
CI01000049_09532855_09551543 RNF24 coding upstream 49252 9532855 ~ 9554478 (+)
CI01000049_09421372_09430717 ADRA1D coding upstream 169385 9421219 ~ 9431606 (+)
CI01000049_08933819_08935755 LRRTM1 coding upstream 665061 8933701 ~ 8935930 (+)
CI01000049_08918472_08920408 LRRTM1 coding upstream 680408 8918354 ~ 8920583 (+)
CI01000049_08707784_08716438 NA coding upstream 884356 8706001 ~ 8716635 (+)
G211815 NA non-coding upstream 25696 9572418 ~ 9575295 (+)
G211804 NA non-coding upstream 89994 9510728 ~ 9510997 (+)
G211803 NA non-coding upstream 91080 9509672 ~ 9509911 (+)
G211799 NA non-coding upstream 118447 9482123 ~ 9482544 (+)
G211817 NA non-coding downstream 8175 9609619 ~ 9617855 (+)
G211833 NA non-coding downstream 36856 9638300 ~ 9644413 (+)
CI01000049_08326623_08329601 NA other upstream 1271076 8326285 ~ 8329915 (+)
G210091 NA other upstream 1722135 7873750 ~ 7878856 (+)
CI01000049_07219171_07224229 NA other upstream 2303929 7218811 ~ 7224268 (+)
G209660 NA other upstream 2718961 6878133 ~ 6882030 (+)
CI01000049_04473766_04475768 GM10043, LSM6, SNRPF, BRAFLDRAFT_125735 other upstream 5124721 4473662 ~ 4476270 (+)

Expression


Co-expression Network