G216783


Basic Information

Item Value
gene id G216783
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 7068398 ~ 7068730 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU245903
CGGGGCGGGCTTCCGACACCAGCGAGGGGGCGAGGGATCTGCCAGGTGAAGGCTGAGAAAGAGCACTCATGCCCGTCTCAAGCCCCGCTGACAGATCCATCTGCGAACCCCACGACATCTTTCTCCGCGCCGCCTCGGCAGACGCGGGCCCAGAGCCGTGGGGAACGCTTGCCTGCGCACTTTCCTCGAAAAGTGCGAGGCGGGAGCGGAGCGTCCTTAAAGGAAGCTTTTCACAATGCTCGCATTCAGCCCCCTCGAAGGCTGAAAGAGCATGCTCCGCTCCCAAACACATCACGCACAAATCGTGTGTATCCCCACCCGTCAGGAAACAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU245903 True 333 lncRNA 0.62 1 7068398 7068730

Neighbor

gene id symbol gene type direction distance location
CI01000050_07047887_07057166 TAS1R2.2 coding downstream 10984 7047552 ~ 7057414 (-)
CI01000050_07037053_07037750 HER3 coding downstream 30584 7036592 ~ 7037814 (-)
CI01000050_07030874_07033872 NA coding downstream 34526 7030635 ~ 7033872 (-)
CI01000050_06949824_06962679 NA coding downstream 104752 6949347 ~ 6963646 (-)
CI01000050_06752838_06802179 ESPN coding downstream 265915 6752781 ~ 6802483 (-)
CI01000050_07155856_07157697 NA coding upstream 86341 7154965 ~ 7157697 (-)
CI01000050_07207399_07217984 OGG1 coding upstream 138445 7207175 ~ 7217984 (-)
CI01000050_07239689_07244721 NA coding upstream 170885 7239615 ~ 7244721 (-)
CI01000050_07307744_07309403 NA coding upstream 238681 7307411 ~ 7310537 (-)
CI01000050_07338022_07340567 ANGPTL7 coding upstream 268715 7337445 ~ 7341011 (-)
G216688 NA non-coding downstream 137083 6930980 ~ 6931315 (-)
G216686 NA non-coding downstream 139575 6928558 ~ 6928823 (-)
G216684 NA non-coding downstream 141321 6926776 ~ 6927077 (-)
G216624 NA non-coding downstream 147388 6920457 ~ 6921010 (-)
G216785 NA non-coding upstream 7236 7075966 ~ 7076189 (-)
G216787 NA non-coding upstream 8605 7077335 ~ 7077568 (-)
G216788 NA non-coding upstream 9356 7078086 ~ 7078321 (-)
G216790 NA non-coding upstream 11743 7080473 ~ 7080716 (-)
G216795 NA non-coding upstream 29021 7097751 ~ 7098065 (-)
G216408 NA other downstream 711887 6356017 ~ 6356511 (-)
G216093 NA other downstream 1516295 5489557 ~ 5552103 (-)
G215935 NA other downstream 1995289 5048916 ~ 5073109 (-)
CI01000050_04564233_04580815 KANSL3 other downstream 2455506 4563687 ~ 4581278 (-)
G214436 NA other downstream 3479341 3525816 ~ 3589057 (-)
G216931 NA other upstream 95365 7164095 ~ 7165401 (-)

Expression


Co-expression Network