G223602


Basic Information

Item Value
gene id G223602
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000052
NCBI id null
chromosome length 3494004
location 1510911 ~ 1511141 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU253630
ATTCATAACAGATAAAAATCAGAACTTGACAGAATCGTAACATAACAGTGTAAAAGAATCATAACATCAAAACAGCAGAATCAGAACAAAATCATAACTTAACATAACGGAATCATAACGTAACAGAATCATAACATATCATGGCAAACAAATCATAAAATCAGAACATAGCATAGTATAAAAGAATCATAACATATATAACATATGATAACATAACCGAATCATAACAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU253630 True 231 lncRNA 0.28 1 1510911 1511141

Neighbor

gene id symbol gene type direction distance location
CI01000052_01481868_01485237 TSPY coding upstream 24062 1481868 ~ 1486849 (+)
CI01000052_01468551_01480835 FOXP3A coding upstream 29929 1468551 ~ 1480982 (+)
CI01000052_01440901_01449517 SUV39H1, SUV39H1B coding upstream 60051 1440901 ~ 1450860 (+)
CI01000052_01405500_01408668 TPP1, TAF10 coding upstream 102049 1403814 ~ 1408862 (+)
CI01000052_01383491_01401660 NA coding upstream 108682 1382150 ~ 1402229 (+)
CI01000052_01550561_01556654 STK38, STK38A coding downstream 39420 1550561 ~ 1557010 (+)
CI01000052_01605314_01607566 NA coding downstream 92649 1603790 ~ 1607908 (+)
CI01000052_01646159_01681413 NA coding downstream 133995 1645136 ~ 1681417 (+)
CI01000052_01698030_01702872 ATP5F1 coding downstream 186249 1697390 ~ 1703488 (+)
CI01000052_01709380_01717983 EPS8L3B coding downstream 198239 1709380 ~ 1718038 (+)
G223597 NA non-coding upstream 14964 1495737 ~ 1495947 (+)
G223444 NA non-coding upstream 149111 1360093 ~ 1361800 (+)
G223579 NA non-coding upstream 162570 1348122 ~ 1348341 (+)
G223464 NA non-coding upstream 174511 1335864 ~ 1336400 (+)
G223414 NA non-coding upstream 205846 1303648 ~ 1305065 (+)
G223605 NA non-coding downstream 18101 1529242 ~ 1529472 (+)
G223616 NA non-coding downstream 97997 1609138 ~ 1609416 (+)
G223618 NA non-coding downstream 105423 1616564 ~ 1617578 (+)
G223620 NA non-coding downstream 130302 1641443 ~ 1642116 (+)
G223629 NA non-coding downstream 196503 1707644 ~ 1708298 (+)
G223545 NA other upstream 239984 1270492 ~ 1270927 (+)
G223694 NA other downstream 538185 2049326 ~ 2104299 (+)
G224953 NA other downstream 1919995 3431136 ~ 3460136 (+)

Expression


Co-expression Network