G235080


Basic Information

Item Value
gene id G235080
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 8974393 ~ 8974682 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU266645
CACTGAGAGGGACTTTATTTCAAATCTTCTTCCCACCACCACCAATATATGGGTTCTGTGTATACAGTACAATCTGCATTATAGTTTTTGGAAAACTATCCAACAGAAAAATGCATTGCAACATTTGAAACACAACAGGCAAAAGTGATCAAATTAGCCATATTATGAGCTAATTAGCTACAATATACTTTACCAACGAGGACTTAAAAATCTTTAAAGCGATATTTCACCCAAAAATGAAAATTCTGTCATTAATTACTCACCCTCATGTCGTTCCAAACCCATAAGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU266645 True 290 lncRNA 0.34 1 8974393 8974682

Neighbor

gene id symbol gene type direction distance location
CI01000054_08953766_08966617 TMEM57, TMEM57A coding downstream 7776 8952134 ~ 8966617 (-)
CI01000054_08937312_08942587 LDLRAP1, LDLRAP1A coding downstream 31806 8937312 ~ 8942587 (-)
CI01000054_08721571_08723333 NA coding downstream 250311 8721008 ~ 8724208 (-)
CI01000054_08710955_08718087 HDAC1, HDAC2.S, HDAC2, HDAC1.S coding downstream 256306 8710787 ~ 8718087 (-)
CI01000054_08692653_08694052 NA coding downstream 280341 8692139 ~ 8694052 (-)
CI01000054_09077309_09080163 NA coding upstream 102149 9076831 ~ 9080812 (-)
CI01000054_09218869_09223868 NA coding upstream 243950 9218632 ~ 9224119 (-)
CI01000054_09453616_09482480 LPCAT1 coding upstream 477427 9452109 ~ 9482723 (-)
CI01000054_09483912_09484282 MRPL36 coding upstream 509130 9483147 ~ 9484282 (-)
CI01000054_09488559_09488870 NA coding upstream 513594 9488276 ~ 9488870 (-)
G235084 NA non-coding downstream 83 8974013 ~ 8974310 (-)
G235064 NA non-coding downstream 61917 8897888 ~ 8912476 (-)
G235061 NA non-coding downstream 78856 8894973 ~ 8895537 (-)
G235060 NA non-coding downstream 79798 8894156 ~ 8894595 (-)
G235049 NA non-coding downstream 98853 8875272 ~ 8875540 (-)
G235096 NA non-coding upstream 12419 8987101 ~ 8987407 (-)
G235097 NA non-coding upstream 12995 8987677 ~ 8987940 (-)
G235099 NA non-coding upstream 14215 8988897 ~ 8989099 (-)
G235135 NA non-coding upstream 92896 9067578 ~ 9067907 (-)
G235150 NA non-coding upstream 110080 9084762 ~ 9084978 (-)
CI01000054_07165957_07169539 HEYL other downstream 1802720 7165435 ~ 7169539 (-)
CI01000054_06629482_06641861 TRIQK other downstream 2320380 6628082 ~ 6642160 (-)
G232274 NA other downstream 3765153 5206199 ~ 5209240 (-)
CI01000054_04671351_04681181 PEF1 other downstream 4302160 4670151 ~ 4681361 (-)
G231645 NA other downstream 4991570 3981847 ~ 3982823 (-)
G235216 NA other upstream 273357 9248039 ~ 9248538 (-)
CI01000054_09864693_09866871 PPP1R11 other upstream 888639 9863321 ~ 9867212 (-)
CI01000054_10817235_10819181 TAC1 other upstream 1829189 10816015 ~ 10819362 (-)
CI01000054_10872970_10881017 SDHAF3 other upstream 1896422 10871104 ~ 10881495 (-)

Expression


Co-expression Network