CI01000054_08937312_08942587 (LDLRAP1, LDLRAP1A)


Basic Information

Item Value
gene id CI01000054_08937312_08942587
gene name LDLRAP1, LDLRAP1A
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 8937312 ~ 8942587 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000054_08937312_08942587.mRNA
AGCTCCCTGAGAATTGGACCGACACAAGAGAGACTCTTCTTGAGGGAATGACCTTTAACCTCCGGCATCTAGGGATGACTCTGGTGGACCAACCCAAAGGCGAGGAGATCTCAGCTGCTGCTGTTAAGAGGATTGTGGCCACAGCCAAAGCCAGCGGAAAGAAACTGCCTAAAGTGGCCCTGAAAGTGTCTCCTCAGGGAATCATCTTGTGCGACAGTGTGTCTAACCAGCTGATCGAGAATATTTCCATATACAGGATATCATACTGCACAGCTGACAAGATGCACAACAAAGTATTTGCTTTCATCTCCCAGAACCAACAGAATGAGACGCTCGAGTGCCATGCATTCCTCTGTGCCAAACGGAAAATGGCCCAGGCGGTCTCGCTCACGGTGGCTCAGGCCTTCAGAGTGGCCTTCGAGTTTTGGGAGGTTGCCAAAGAAGAGAGAGAGCATCGTGTGAAATGGGATTCAGCTGGAGAGATGTCTAACAGTTCACAGTCAGAGAGATCGGTCAGCCTGACCAGCCTGAAAGGAGGAG

Function

symbol description
ldlrap1a Predicted to be active in early endosome. Is expressed in several structures, including apical ectodermal ridge pectoral fin bud; axis; cardiovascular system; nervous system; and pectoral fin. Human ortholog(s) of this gene implicated in autosomal recessive hypercholesterolemia. Orthologous to human LDLRAP1 (low density lipoprotein receptor adaptor protein 1).
ldlrap1 Enables several functions, including AP-1 adaptor complex binding activity; AP-2 adaptor complex binding activity; and amyloid-beta binding activity. Involved in several processes, including cholesterol homeostasis; low-density lipoprotein particle clearance; and receptor-mediated endocytosis. Located in several cellular components, including basal plasma membrane; cytoplasmic side of plasma membrane; and endosome. Implicated in autosomal recessive hypercholesterolemia.

GO:

id name namespace
GO:0005575 cellular_component cellular_component

KEGG:

id description
K12474 LDLRAP1, ARH; low density lipoprotein receptor adapter protein 1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000054_08937312_08942587.mRNA True 540 mRNA 0.51 5 8937312 8942587

Neighbor

gene id symbol gene type direction distance location
CI01000054_08721571_08723333 NA coding downstream 213230 8721008 ~ 8724208 (-)
CI01000054_08710955_08718087 HDAC1, HDAC2.S, HDAC2, HDAC1.S coding downstream 219225 8710787 ~ 8718087 (-)
CI01000054_08692653_08694052 NA coding downstream 243260 8692139 ~ 8694052 (-)
CI01000054_08652832_08667152 NA coding downstream 268383 8652789 ~ 8668929 (-)
CI01000054_08574533_08590975 NA coding downstream 346020 8574480 ~ 8591292 (-)
CI01000054_08953766_08966617 TMEM57, TMEM57A coding upstream 9547 8952134 ~ 8966617 (-)
CI01000054_09077309_09080163 NA coding upstream 134244 9076831 ~ 9080812 (-)
CI01000054_09218869_09223868 NA coding upstream 276045 9218632 ~ 9224119 (-)
CI01000054_09453616_09482480 LPCAT1 coding upstream 509522 9452109 ~ 9482723 (-)
CI01000054_09483912_09484282 MRPL36 coding upstream 541225 9483147 ~ 9484282 (-)
G235064 NA non-coding downstream 24836 8897888 ~ 8912476 (-)
G235061 NA non-coding downstream 41775 8894973 ~ 8895537 (-)
G235060 NA non-coding downstream 42717 8894156 ~ 8894595 (-)
G235049 NA non-coding downstream 61772 8875272 ~ 8875540 (-)
G235041 NA non-coding downstream 73809 8863172 ~ 8863503 (-)
G235084 NA non-coding upstream 31426 8974013 ~ 8974310 (-)
G235080 NA non-coding upstream 31806 8974393 ~ 8974682 (-)
G235096 NA non-coding upstream 44514 8987101 ~ 8987407 (-)
G235097 NA non-coding upstream 45090 8987677 ~ 8987940 (-)
G235099 NA non-coding upstream 46310 8988897 ~ 8989099 (-)
CI01000054_07165957_07169539 HEYL other downstream 1765639 7165435 ~ 7169539 (-)
CI01000054_06629482_06641861 TRIQK other downstream 2283299 6628082 ~ 6642160 (-)
G232274 NA other downstream 3728072 5206199 ~ 5209240 (-)
CI01000054_04671351_04681181 PEF1 other downstream 4265079 4670151 ~ 4681361 (-)
G231645 NA other downstream 4954489 3981847 ~ 3982823 (-)
G235216 NA other upstream 305452 9248039 ~ 9248538 (-)
CI01000054_09864693_09866871 PPP1R11 other upstream 920734 9863321 ~ 9867212 (-)
CI01000054_10817235_10819181 TAC1 other upstream 1861284 10816015 ~ 10819362 (-)
CI01000054_10872970_10881017 SDHAF3 other upstream 1928517 10871104 ~ 10881495 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_014113 ldlrap1a coding NC_007130.7 CM002903.2 29337789 ~ 29363779 (+)
bowfin (Amia calva) AMCG00011049 ldlrap1,arhb,LOC106579967 coding CM030133.1 CM030133.1 8866341 ~ 8886705 (-)