G71512



Basic Information


Item Value
gene id G71512
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 22557383 ~ 22557663 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU89417
ccatgaccctgttgccggttcaccgcttttccttccttggaccacttttgataggtactgaccactgcagaccgggaacaccccacaagagctgcagttttggagatgctctgacccagtcgtctagccatcacagtttggcccttgtcaaagtcgctcagatccttacgcttgcccatttttcctgcttctaacacatcaactttgaggacaagatgttcacttgctgcctaatatatcccacccactgacaggtgccatgataacgagattatcagtgt

Function


GO: NA

KEGG:

id description
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA


RNA id representative length rna type GC content exon number start site end site
TU89417 True 281 lncRNA 0.49 1 22557383 22557663

Neighbor


gene id symbol gene type direction distance location
AMCG00014631 NA coding downstream 224573 22320028 ~ 22332810 (-)
AMCG00014628 NA coding downstream 432017 22119740 ~ 22125366 (-)
AMCG00014629 pou4f1 coding downstream 443752 22112182 ~ 22113631 (-)
AMCG00014627 pcdh9 coding downstream 777882 21776406 ~ 21779501 (-)
AMCG00014626 NA coding downstream 929493 21620825 ~ 21627890 (-)
AMCG00014633 NA coding upstream 1045946 23603609 ~ 23604731 (-)
AMCG00014634 NA coding upstream 1207415 23765078 ~ 24324642 (-)
AMCG00014639 NA coding upstream 2342428 24900091 ~ 24910282 (-)
AMCG00014640 NA coding upstream 2356640 24914303 ~ 24927812 (-)
AMCG00014641 sox21 coding upstream 2403283 24960946 ~ 24961689 (-)
G71496 LOC100846954 non-coding downstream 250436 22306634 ~ 22306947 (-)
G71461 NA non-coding downstream 335916 22221070 ~ 22221467 (-)
G71451 NA non-coding downstream 559195 21997922 ~ 21998188 (-)
G71379 NA non-coding downstream 2370415 20186629 ~ 20186968 (-)
G71371 NA non-coding downstream 2479374 20073025 ~ 20078009 (-)
G71526 NA non-coding upstream 297686 22855349 ~ 22855619 (-)
G71539 NA non-coding upstream 404206 22961869 ~ 22962070 (-)
G71540 NA non-coding upstream 426486 22984149 ~ 22984567 (-)
G71561 LOC107575789 non-coding upstream 854953 23412616 ~ 23412984 (-)
G71582 NA non-coding upstream 1147536 23705199 ~ 23705420 (-)
AMCG00014630 LOC107672672 other downstream 312468 22225924 ~ 22244915 (-)
AMCG00014603 tpt1,LOC106582181 other downstream 3332153 19217722 ~ 19225230 (-)
AMCG00014604 kctd4,LOC107688678,LOC107748885 other downstream 3353816 19201803 ~ 19203567 (-)
AMCG00014567 mzt1,si:dkey-15d12.2 other downstream 4535288 17990651 ~ 18022095 (-)
AMCG00014559 NA other downstream 4936232 17589267 ~ 17621151 (-)
AMCG00014693 NA other upstream 4727757 27285420 ~ 27304597 (-)
AMCG00014692 LOC107756725 other upstream 4778032 27335695 ~ 27369527 (-)
G72236 rpl8,LOC107595836,LOC107748161 other upstream 5772076 28329739 ~ 28332482 (-)
G72477 LOC106598269,LOC101158751,LOC106586690,LOC103361283 other upstream 6831627 29389290 ~ 29398305 (-)
AMCG00014775 NA other upstream 8283860 30841523 ~ 30846800 (-)

Expression



Co-expression Network