AMCG00021044


Basic Information

Item Value
gene id AMCG00021044
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 642123 ~ 665556 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021044
ATGCGATCCACAGTGCAGGAGCACAGCGCTTTTAGGTTTGCAGTGCAACTGTACAACACCAATCAAAATGTGACCGAGAAACCCTTCCACCTGAACTACCATGTAGATCACCTGGAGTCCTCCAACAGCTTCTCTGTCACCCATGCTCATGTGGTGCTGCAGATCAAAGAGGTGACTGGGGCTGGAGTGGACTGGCATGTGCACTGGGTTTACAGCGTGCCGTACCCACAGTGGGCAGAGAACTCGAGTGCTGCGAGAGGGAGTGAAGTCATCCTCTCGCTGAAGGCTCGGCGCCCCACTGCCATAACCACCTTCAAAGGGCTGGAGTACTCCATCCCTTTAATTGGCACACCACATGATGGAGAATGA

Function

GO:

id name namespace
GO:0035235 ionotropic glutamate receptor signaling pathway biological_process
GO:0034220 ion transmembrane transport biological_process
GO:0045211 postsynaptic membrane cellular_component
GO:0030054 cell junction cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005234 extracellularly glutamate-gated ion channel activity molecular_function
GO:0004970 ionotropic glutamate receptor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021044 True 369 mRNA 0.54 3 642123 665556

Neighbor

gene id symbol gene type direction distance location
AMCG00021037 psmd10 coding upstream 301721 336891 ~ 340402 (+)
AMCG00021036 acsl4,LOC106603377,LOC105025984,LOC107666599,LOC107751919 coding upstream 311290 314436 ~ 330833 (+)
AMCG00021038 pin4 coding upstream 348931 291501 ~ 293192 (+)
AMCG00021040 mid2,LOC107707205 coding upstream 399606 208101 ~ 242517 (+)
AMCG00021039 mid2,LOC107561279,LOC107670185,LOC107707205 coding upstream 457454 179595 ~ 184669 (+)
AMCG00021043 gria3,LOC104962462,LOC107733408 coding downstream 6474 672030 ~ 674577 (+)
AMCG00021046 gria3,LOC105893193 coding downstream 52071 717627 ~ 736985 (+)
AMCG00021045 NA coding downstream 83852 749408 ~ 756739 (+)
AMCG00021047 NA coding downstream 183989 849545 ~ 856470 (+)
AMCG00021050 stag2,LOC107561283,LOC107600152 coding downstream 214250 879806 ~ 897880 (+)
G83114 NA non-coding upstream 355991 285921 ~ 286132 (+)
G83086 NA non-coding upstream 396804 243756 ~ 245319 (+)
G83153 NA non-coding downstream 111603 777159 ~ 782656 (+)
G83221 NA non-coding downstream 680895 1346451 ~ 1346771 (+)
G83325 NA non-coding downstream 1417558 2083114 ~ 2083451 (+)
G83338 NA non-coding downstream 1439626 2105182 ~ 2106906 (+)
G83374 NA non-coding downstream 1535738 2201294 ~ 2201559 (+)
AMCG00021049 NA other downstream 252450 918006 ~ 926475 (+)
AMCG00021063 NA other downstream 1251932 1917488 ~ 1919366 (+)
AMCG00021076 NA other downstream 1543926 2209482 ~ 2230147 (+)
G83624 NA other downstream 3132285 3797841 ~ 3798783 (+)
AMCG00021113 vma21,LOC107565438,LOC107741184,LOC107680358,LOC108442053 other downstream 3461514 4127070 ~ 4129373 (+)

Expression


Co-expression Network