AMCG00021043 (gria3,LOC104962462,LOC107733408)


Basic Information

Item Value
gene id AMCG00021043
gene name gria3,LOC104962462,LOC107733408
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030130.1
NCBI id CM030130.1
chromosome length 39556810
location 672030 ~ 674577 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00021043
ATGCAGCTCCAGCCCGTCAAGAGGGATGGGAAGTCAGGCGCGGAGATGCTGGGGTCACTCGGGCTGAGGGTTGTGTCAACACGAGTACGGATGAGGCCTAACGGTTTTCTGCTGATTTCTTTTCCAGTTTGCTCACAGTTCTCCAGAGGAGTTTACGCCATCTTCGGATTCTATGACAAGAAGTCCATGAACACGTTGACTTCCTTCTGTGGGGCCCTCCATACCTCCTTCGTCACACCCAGCTACCCCACCGACGCGGATGTTCAGTTTGTCATCCAGATGCGACCCGCGTTGAAAGGGGCCGTGCTGAGTCTGCTCTCACACTACAAATGGGAGAAATTTGTCTACCTCTACGACACCGAAAGAGAAGATGTCAATAGCCAGGCTTCTTCAAGTACTACCGAGTCACTGTACTAG

Function

symbol description
gria3 Enables AMPA glutamate receptor activity. Predicted to be involved in regulation of receptor recycling and response to lithium ion. Predicted to be located in membrane; parallel fiber to Purkinje cell synapse; and postsynaptic density. Predicted to be part of AMPA glutamate receptor complex. Predicted to be active in dendritic spine; glutamatergic synapse; and plasma membrane. Predicted to be integral component of postsynaptic density membrane and integral component of presynaptic membrane. Implicated in syndromic X-linked intellectual disability 94.

NR:

description
PREDICTED: glutamate receptor 3 isoform X7

GO:

id name namespace
GO:0006811 ion transport biological_process
GO:0045211 postsynaptic membrane cellular_component
GO:0030054 cell junction cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005234 extracellularly glutamate-gated ion channel activity molecular_function
GO:0004970 ionotropic glutamate receptor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00021043 True 417 mRNA 0.53 3 672030 674577

Neighbor

gene id symbol gene type direction distance location
AMCG00021044 NA coding upstream 6474 642123 ~ 665556 (+)
AMCG00021037 psmd10 coding upstream 331628 336891 ~ 340402 (+)
AMCG00021036 acsl4,LOC106603377,LOC105025984,LOC107666599,LOC107751919 coding upstream 341197 314436 ~ 330833 (+)
AMCG00021038 pin4 coding upstream 378838 291501 ~ 293192 (+)
AMCG00021040 mid2,LOC107707205 coding upstream 429513 208101 ~ 242517 (+)
AMCG00021046 gria3,LOC105893193 coding downstream 43050 717627 ~ 736985 (+)
AMCG00021045 NA coding downstream 74831 749408 ~ 756739 (+)
AMCG00021047 NA coding downstream 174968 849545 ~ 856470 (+)
AMCG00021050 stag2,LOC107561283,LOC107600152 coding downstream 205229 879806 ~ 897880 (+)
AMCG00021052 NA coding downstream 370598 1045175 ~ 1052182 (+)
G83114 NA non-coding upstream 385898 285921 ~ 286132 (+)
G83086 NA non-coding upstream 426711 243756 ~ 245319 (+)
G83153 NA non-coding downstream 102582 777159 ~ 782656 (+)
G83221 NA non-coding downstream 671874 1346451 ~ 1346771 (+)
G83325 NA non-coding downstream 1408537 2083114 ~ 2083451 (+)
G83338 NA non-coding downstream 1430605 2105182 ~ 2106906 (+)
G83374 NA non-coding downstream 1526717 2201294 ~ 2201559 (+)
AMCG00021049 NA other downstream 243429 918006 ~ 926475 (+)
AMCG00021063 NA other downstream 1242911 1917488 ~ 1919366 (+)
AMCG00021076 NA other downstream 1534905 2209482 ~ 2230147 (+)
G83624 NA other downstream 3123264 3797841 ~ 3798783 (+)
AMCG00021113 vma21,LOC107565438,LOC107741184,LOC107680358,LOC108442053 other downstream 3452493 4127070 ~ 4129373 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000032_00932336_00974922 GRIA3B, GRIA3 coding CI01000032 null 932336 ~ 974922 (+)