G63962 (grid2,LOC107669587,LOC107751431,LOC107711862,LOC107680191)


Basic Information

Item Value
gene id G63962
gene name grid2,LOC107669587,LOC107751431,LOC107711862,LOC107680191
gene type non-coding
species tiger barb (Puntius tetrazona)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_056706.1
NCBI id CM032075.1
chromosome length 24299999
location 14099665 ~ 14100151 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome

Sequence

>TU94669
AAATAAGACATTAACCCGCACCTAATTAGTATGGGAATTCGGTGGGGGAATTTTCAGAGTTAAATCACTCATAACTCAAGCACCATTAAGCCACATTAGCGCATTTTTGCTTTGATATCTCTATTCAGAGAACATTAGCGCAATCTTCACAAACCGTTGCTTAGCTAAGCAGCGTAATTAGATAAATGGTGGCGGTAGTCATAGCGCCCGGAGGACCCTACCTTCCGGATGCCTTCTTTCGATTCCTCAACGTTGTTTTCGGCTCCTCCTGTCCGGTTGATCATCCTCCACATCTGCGAGTACATGGGGTCCCTCTCAAAAGGGTTCATGCCTTTGCTGCGGACCTGGTCGTAGACGGCCGAGTCCAGAACCGTGCCATATGGCAAGTCTGTCTGCTTAGCCAAATCCTGCAGAGACCTGGAGGGCAACATTGAAACATATTACAATCGGAAGAATTTGAGAAACAATAGCATTGGGTTGATGCCTG

Function

symbol description
grid2 Predicted to enable ionotropic glutamate receptor activity and transmitter-gated ion channel activity involved in regulation of postsynaptic membrane potential. Predicted to be involved in glutamatergic synaptic transmission and modulation of chemical synaptic transmission. Predicted to act upstream of or within ionotropic glutamate receptor signaling pathway. Predicted to be integral component of plasma membrane. Predicted to be active in postsynaptic membrane. Is expressed in brain and eye. Human ortholog(s) of this gene implicated in autosomal recessive spinocerebellar ataxia 18. Orthologous to human GRID2 (glutamate ionotropic receptor delta type subunit 2).

NR:

description
PREDICTED: glutamate receptor ionotropic, delta-2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU94669 True 487 lncRNA 0.47 1 14099665 14100151

Neighbor

gene id symbol gene type direction distance location
cebpb cebpb,LOC107556312,LOC107669676,LOC107751442,LOC107594515,LOC107679873,LOC107711812 coding downstream 458183 13639945 ~ 13641482 (-)
adipor1b adipor1b,LOC107751445,LOC107679819,LOC107594512,LOC107711855 coding downstream 484327 13608854 ~ 13615338 (-)
LOC122351021 klhl12,LOC107679803,LOC107556315,LOC107711853,LOC107751446,LOC107594517 coding downstream 491388 13599250 ~ 13608277 (-)
tuba5 tuba8l,LOC108265838,LOC108425079,LOC107679810,LOC107711852,LOC107594520,LOC103031418 coding downstream 501818 13593701 ~ 13597847 (-)
kdm5bb LOC107751449,LOC107556320,LOC107711851 coding downstream 508489 13571079 ~ 13591176 (-)
LOC122350319 LOC107574771,LOC107751454,LOC107669655 coding upstream 72903 14173054 ~ 14175823 (-)
LOC122350320 prf1.5,LOC107751453,LOC107574770,LOC107594505,LOC107711865,LOC107679935 coding upstream 81381 14181532 ~ 14186141 (-)
mpeg1.1 mpeg1.1,LOC107724877,LOC107669601,LOC107602834,LOC107679909,LOC107724864,LOC107751428,LOC107602817 coding upstream 87278 14187429 ~ 14190244 (-)
LOC122349900 LOC107724883,LOC107580262,LOC107669607 coding upstream 93682 14193833 ~ 14194501 (-)
slc20a2 slc20a2,LOC107724891,LOC107669617,LOC107602837,LOC107594502,LOC107711867 coding upstream 125205 14225356 ~ 14259044 (-)
G63944 NA non-coding downstream 36925 14062497 ~ 14062740 (-)
G63942 NA non-coding downstream 92647 14006813 ~ 14007018 (-)
G63941 grid2,LOC107711862,LOC107669587,LOC107568412,LOC107594506 non-coding downstream 101699 13997682 ~ 13997966 (-)
G63874 NA non-coding downstream 374191 13725069 ~ 13725474 (-)
G63873 NA non-coding downstream 375665 13723731 ~ 13724000 (-)
G63963 NA non-coding upstream 17579 14117730 ~ 14118002 (-)
G63956 grid2,LOC107669587,LOC107711862,LOC107751431,LOC107680191 non-coding upstream 28038 14128189 ~ 14128422 (-)
G63955 grid2,LOC107568412,LOC107751431,LOC107594506,LOC107680191,LOC107711862 non-coding upstream 31240 14131391 ~ 14137423 (-)
G63975 NA non-coding upstream 102895 14203046 ~ 14203270 (-)
G63976 NA non-coding upstream 103491 14203642 ~ 14203921 (-)
G63933 LOC107556304,LOC107751435,LOC107594508 other downstream 236415 13809428 ~ 13863250 (-)
mc3r mc3r,LOC107751459,LOC107669608,LOC107711834,LOC107680356 other downstream 379151 13716628 ~ 13720514 (-)
tafa3b si:ch211-254n4.3,fam19a3,LOC107711931,LOC107591764,LOC107562776,LOC107669582,LOC102289964,LOC104918365,LOC106582736,LOC105921069,LOC106517667,LOC108231490,LOC106937909 other downstream 853535 13185867 ~ 13246130 (-)
zmynd12 zymnd12,LOC107591768,LOC107711949,LOC107679700 other downstream 1016293 12985654 ~ 13083372 (-)
foxp3a foxp3a,si:ch211-167b20.8,LOC107669635,LOC107731227,LOC107550508,LOC107711972,LOC107679368,LOC107591799,LOC107591800 other downstream 1595512 12489197 ~ 12504153 (-)
LOC122350784 zgc:162939,LOC107602843,LOC107674500,LOC107724903 other upstream 285449 14385600 ~ 14455243 (-)
slc20a1a slc20a1a,LOC107724894,LOC107711884,LOC107686402,LOC107667554,LOC107602858,LOC108440301 other upstream 623561 14723712 ~ 14731391 (-)
G64228 NA other upstream 679380 14779531 ~ 14781710 (-)
G64353 hmcn2,LOC107723245,LOC107659581,LOC107570300 other upstream 1183710 15283861 ~ 15284130 (-)
mvb12bb mvb12b,LOC107550570,LOC107753158,LOC107723228 other upstream 1549075 15649226 ~ 15700896 (-)

Expression


Co-expression Network