RNA id: TCONS_00018151



Basic Information


Item Value
RNA id TCONS_00018151
length 86
RNA type miRNA
GC content 0.51
exon number 1
gene id XLOC_009234
representative True

Chromosome Information


Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 24901551 ~ 24927093 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GCTGACCTGCAGCAGTTCTTCACTGGCAAGCTTTATGTCCTTGTGTACCAGCTAAAGCTGCCAGCTGAAGAACTGTTGTGGTTGGC

Function


GO:

id name namespace
GO:0072068 late distal convoluted tubule development biological_process
GO:0048731 system development biological_process
GO:0009259 ribonucleotide metabolic process biological_process
GO:0048468 cell development biological_process
GO:0009260 ribonucleotide biosynthetic process biological_process
GO:1902600 proton transmembrane transport biological_process
GO:0046034 ATP metabolic process biological_process
GO:0006935 chemotaxis biological_process
GO:0030154 cell differentiation biological_process
GO:0048513 animal organ development biological_process
GO:0000902 cell morphogenesis biological_process
GO:0006091 generation of precursor metabolites and energy biological_process
GO:0000904 cell morphogenesis involved in differentiation biological_process
GO:0031290 retinal ganglion cell axon guidance biological_process
GO:1901293 nucleoside phosphate biosynthetic process biological_process
GO:0030182 neuron differentiation biological_process
GO:0048812 neuron projection morphogenesis biological_process
GO:0042773 ATP synthesis coupled electron transport biological_process
GO:0042775 mitochondrial ATP synthesis coupled electron transport biological_process
GO:0006119 oxidative phosphorylation biological_process
GO:0006120 mitochondrial electron transport, NADH to ubiquinone biological_process
GO:0007275 multicellular organism development biological_process
GO:0019857 5-methylcytosine metabolic process biological_process
GO:0120039 plasma membrane bounded cell projection morphogenesis biological_process
GO:0022900 electron transport chain biological_process
GO:0022904 respiratory electron transport chain biological_process
GO:0006163 purine nucleotide metabolic process biological_process
GO:0006164 purine nucleotide biosynthetic process biological_process
GO:0017144 drug metabolic process biological_process
GO:0048858 cell projection morphogenesis biological_process
GO:0009117 nucleotide metabolic process biological_process
GO:0009123 nucleoside monophosphate metabolic process biological_process
GO:0048869 cellular developmental process biological_process
GO:0009124 nucleoside monophosphate biosynthetic process biological_process
GO:0009126 purine nucleoside monophosphate metabolic process biological_process
GO:0009127 purine nucleoside monophosphate biosynthetic process biological_process
GO:0032989 cellular component morphogenesis biological_process
GO:0032990 cell part morphogenesis biological_process
GO:0046390 ribose phosphate biosynthetic process biological_process
GO:0055086 nucleobase-containing small molecule metabolic process biological_process
GO:0019637 organophosphate metabolic process biological_process
GO:0006753 nucleoside phosphate metabolic process biological_process
GO:0006754 ATP biosynthetic process biological_process
GO:0009141 nucleoside triphosphate metabolic process biological_process
GO:0009142 nucleoside triphosphate biosynthetic process biological_process
GO:0009144 purine nucleoside triphosphate metabolic process biological_process
GO:0009145 purine nucleoside triphosphate biosynthetic process biological_process
GO:0009150 purine ribonucleotide metabolic process biological_process
GO:0009152 purine ribonucleotide biosynthetic process biological_process
GO:1901135 carbohydrate derivative metabolic process biological_process
GO:1901137 carbohydrate derivative biosynthetic process biological_process
GO:0009156 ribonucleoside monophosphate biosynthetic process biological_process
GO:0040011 locomotion biological_process
GO:0072521 purine-containing compound metabolic process biological_process
GO:0021954 central nervous system neuron development biological_process
GO:0072522 purine-containing compound biosynthetic process biological_process
GO:0006211 5-methylcytosine catabolic process biological_process
GO:0009161 ribonucleoside monophosphate metabolic process biological_process
GO:0009165 nucleotide biosynthetic process biological_process
GO:0097485 neuron projection guidance biological_process
GO:0009167 purine ribonucleoside monophosphate metabolic process biological_process
GO:0009168 purine ribonucleoside monophosphate biosynthetic process biological_process
GO:0061564 axon development biological_process
GO:0015980 energy derivation by oxidation of organic compounds biological_process
GO:0048666 neuron development biological_process
GO:0048667 cell morphogenesis involved in neuron differentiation biological_process
GO:0007399 nervous system development biological_process
GO:0015985 energy coupled proton transport, down electrochemical gradient biological_process
GO:0019693 ribose phosphate metabolic process biological_process
GO:0015986 ATP synthesis coupled proton transport biological_process
GO:0007409 axonogenesis biological_process
GO:0007411 axon guidance biological_process
GO:0009199 ribonucleoside triphosphate metabolic process biological_process
GO:0042330 taxis biological_process
GO:0009201 ribonucleoside triphosphate biosynthetic process biological_process
GO:0072025 distal convoluted tubule development biological_process
GO:0009205 purine ribonucleoside triphosphate metabolic process biological_process
GO:0009206 purine ribonucleoside triphosphate biosynthetic process biological_process
GO:0022008 neurogenesis biological_process
GO:0031175 neuron projection development biological_process
GO:0045333 cellular respiration biological_process
GO:0098803 respiratory chain complex cellular_component
GO:0005743 mitochondrial inner membrane cellular_component
GO:0005746 mitochondrial respirasome cellular_component
GO:0005747 mitochondrial respiratory chain complex I cellular_component
GO:0005753 mitochondrial proton-transporting ATP synthase complex cellular_component
GO:0030964 NADH dehydrogenase complex cellular_component
GO:0044429 obsolete mitochondrial part cellular_component
GO:0016469 proton-transporting two-sector ATPase complex cellular_component
GO:0044455 obsolete mitochondrial membrane part cellular_component
GO:0033177 proton-transporting two-sector ATPase complex, proton-transporting domain cellular_component
GO:0019866 organelle inner membrane cellular_component
GO:0070069 cytochrome complex cellular_component
GO:0005581 collagen trimer cellular_component
GO:0032991 protein-containing complex cellular_component
GO:1990204 oxidoreductase complex cellular_component
GO:0031090 organelle membrane cellular_component
GO:0045259 proton-transporting ATP synthase complex cellular_component
GO:0045261 proton-transporting ATP synthase complex, catalytic core F(1) cellular_component
GO:0045263 proton-transporting ATP synthase complex, coupling factor F(o) cellular_component
GO:0045271 respiratory chain complex I cellular_component
GO:0045277 respiratory chain complex IV cellular_component
GO:0031966 mitochondrial membrane cellular_component
GO:0031967 organelle envelope cellular_component
GO:0031975 envelope cellular_component
GO:0000275 mitochondrial proton-transporting ATP synthase complex, catalytic sector F(1) cellular_component
GO:0000276 mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) cellular_component
GO:0070469 respirasome cellular_component
GO:0098796 membrane protein complex cellular_component
GO:0098798 mitochondrial protein-containing complex cellular_component
GO:0005739 mitochondrion cellular_component
GO:0098800 inner mitochondrial membrane protein complex cellular_component
GO:0005740 mitochondrial envelope cellular_component
GO:0009055 electron transfer activity molecular_function
GO:0044769 ATPase activity, coupled to transmembrane movement of ions, rotational mechanism molecular_function
GO:0070579 methylcytosine dioxygenase activity molecular_function
GO:0022890 inorganic cation transmembrane transporter activity molecular_function
GO:0015002 heme-copper terminal oxidase activity molecular_function
GO:0046933 proton-transporting ATP synthase activity, rotational mechanism molecular_function
GO:0005201 extracellular matrix structural constituent molecular_function
GO:0015318 inorganic molecular entity transmembrane transporter activity molecular_function
GO:0015075 ion transmembrane transporter activity molecular_function
GO:0015077 monovalent inorganic cation transmembrane transporter activity molecular_function
GO:0015078 proton transmembrane transporter activity molecular_function
GO:0008324 cation transmembrane transporter activity molecular_function
GO:0004129 cytochrome-c oxidase activity molecular_function
GO:0016675 oxidoreductase activity, acting on a heme group of donors molecular_function
GO:0016676 oxidoreductase activity, acting on a heme group of donors, oxygen as acceptor molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000116582

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00018144 lncRNA downstream 289489 24592325 ~ 24618905 (-) True XLOC_009230
TCONS_00018145 lncRNA downstream 289520 24592325 ~ 24618874 (-) False XLOC_009230
TCONS_00019157 lncRNA downstream 345333 24561821 ~ 24563061 (-) True XLOC_009228
TCONS_00018135 lncRNA downstream 1115114 23792650 ~ 23793280 (-) True XLOC_009222
TCONS_00019156 lncRNA downstream 1261441 23644312 ~ 23646953 (-) False XLOC_009216
TCONS_00018824 lncRNA upstream 59613 24968092 ~ 24974112 (-) True XLOC_009236
TCONS_00018168 lncRNA upstream 306649 25215128 ~ 25229469 (-) False XLOC_009244
TCONS_00019163 lncRNA upstream 790333 25698812 ~ 25760624 (-) False XLOC_009254
TCONS_00019164 lncRNA upstream 790333 25698812 ~ 25876114 (-) False XLOC_009254
TCONS_00019165 lncRNA upstream 810265 25718744 ~ 25760609 (-) False XLOC_009254
TCONS_00018150 mRNA downstream 23610 24878480 ~ 24884784 (-) True XLOC_009233
TCONS_00018149 mRNA downstream 24438 24873388 ~ 24883956 (-) False XLOC_009233
TCONS_00018148 mRNA downstream 38568 24845145 ~ 24869826 (-) True XLOC_009232
TCONS_00018147 mRNA downstream 232079 24673729 ~ 24676315 (-) True XLOC_009231
TCONS_00018146 mRNA downstream 232183 24673283 ~ 24676211 (-) False XLOC_009231
TCONS_00018152 mRNA upstream 37842 24946321 ~ 24960730 (-) False XLOC_009235
TCONS_00018153 mRNA upstream 42203 24950682 ~ 24960781 (-) True XLOC_009235
TCONS_00018154 mRNA upstream 98730 25007209 ~ 25010400 (-) True XLOC_009237
TCONS_00018155 mRNA upstream 127468 25035947 ~ 25039083 (-) True XLOC_009238
TCONS_00018156 mRNA upstream 171562 25080041 ~ 25083200 (-) True XLOC_009239
TCONS_00018142 other downstream 749327 24158953 ~ 24159067 (-) True XLOC_009227
TCONS_00018102 other downstream 1953262 22955017 ~ 22955132 (-) True XLOC_009204
TCONS_00018101 other downstream 2187513 22720765 ~ 22720881 (-) True XLOC_009203
TCONS_00018099 other downstream 2647397 22260881 ~ 22260997 (-) True XLOC_009200
TCONS_00018076 other downstream 3368118 21521803 ~ 21540276 (-) True XLOC_009187
TCONS_00018157 other upstream 176342 25084821 ~ 25093717 (-) False XLOC_009240
TCONS_00018169 other upstream 330010 25238489 ~ 25268641 (-) False XLOC_009244
TCONS_00018173 other upstream 370366 25278845 ~ 25284045 (-) True XLOC_009245
TCONS_00018187 other upstream 669709 25578188 ~ 25579500 (-) False XLOC_009252
TCONS_00018188 other upstream 669996 25578475 ~ 25584862 (-) True XLOC_009252