RNA id: TCONS_00019876



Basic Information


Item Value
RNA id TCONS_00019876
length 614
lncRNA type retained_intron
GC content 0.45
exon number 4
gene id XLOC_009980
representative True

Chromosome Information


Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 27564270 ~ 27581488 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


AACACCAACATTGAGTTGCGAGCTGCTGTGTACTCAGTGCGTGGAGAGTTTCTGAGATGGGAAAGCGTTGGTAGAGGCAACCTTCAGCTCTGTCCAGACACCCCTACCAGACAACAGTCTGCCTTCAAATTCGGGACAGCCTACAAGCAGAGTTGTGTGCTATCTGTGTCAGAGCTCTTAACTGGTTATCCAGAGCCTTTGTTCTATGATGTGTTCCTGGTCATTCAGAATTCCCAAGACAATCGTCTTCTTGCGGTGCCTCTCCTAAATGCCAATCAGCAGTTTAACGGCCAGTTTGTCAATCAGGGTATAATATCCAATTATATATTTGATCATCAGATGTTAAGGCATTGCTATTTTATTATAGTGTTAACTCCTCATTTATTAGGATCTGACATGAGTAAATGGTTCCTGACCCGAAGGCTGATGCTTGTCGACACATTGAGTGGAAGAGAGAAGTCTATAAGTTCTTCACCCGTAGTTATACGAGTGGCTTCTGACATTAAGATCGGGTTTCAGCTGGTACCAAATACACAGAAGGGACAGGTTTACCCTCCACTGATGAGTGTGGCCTACTCGGATATACAGATCAAAGACCCCAGCACACAGACTGT

Function


GO:

id name namespace
GO:0003341 cilium movement biological_process
GO:0007369 gastrulation biological_process
GO:0060271 cilium assembly biological_process
GO:0010826 negative regulation of centrosome duplication biological_process
GO:0060027 convergent extension involved in gastrulation biological_process
GO:0060028 convergent extension involved in axis elongation biological_process
GO:0036038 MKS complex cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG:

id description
ko03036 Chromosome and associated proteins

ZFIN:

id description
ZDB-GENE-080716-1 Acts upstream of or within cilium assembly; cilium movement; and convergent extension. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be part of MKS complex. Predicted to be active in ciliary transition zone. Used to study ciliopathy and meningocele. Human ortholog(s) of this gene implicated in Bardet-Biedl syndrome (multiple); COACH syndrome; Joubert syndrome 6; Meckel syndrome 3; and nephronophthisis 11. Orthologous to human TMEM67 (transmembrane protein 67).

Ensembl:

ensembl_id ENSDART00000144875

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00021947 lncRNA upstream 13048 27543308 ~ 27556789 (+) False XLOC_009979
TCONS_00021948 lncRNA upstream 13048 27543497 ~ 27556789 (+) False XLOC_009979
TCONS_00021949 lncRNA upstream 13048 27543582 ~ 27556789 (+) False XLOC_009979
TCONS_00021950 lncRNA upstream 13048 27543588 ~ 27556789 (+) False XLOC_009979
TCONS_00021951 lncRNA upstream 13048 27547495 ~ 27556789 (+) False XLOC_009979
TCONS_00021720 lncRNA downstream 268576 27839927 ~ 27873367 (+) True XLOC_009984
TCONS_00021952 lncRNA downstream 478203 28049554 ~ 28050028 (+) True XLOC_009986
TCONS_00021953 lncRNA downstream 698664 28270015 ~ 28271395 (+) False XLOC_009987
TCONS_00021954 lncRNA downstream 1089044 28660395 ~ 28667333 (+) False XLOC_009994
TCONS_00021955 lncRNA downstream 1089052 28660403 ~ 28663860 (+) True XLOC_009994
TCONS_00019868 mRNA upstream 10941 27543545 ~ 27558896 (+) False XLOC_009979
TCONS_00019871 mRNA upstream 11264 27543893 ~ 27558573 (+) False XLOC_009979
TCONS_00019864 mRNA upstream 67135 27442549 ~ 27502702 (+) False XLOC_009978
TCONS_00019865 mRNA upstream 67356 27444098 ~ 27502481 (+) True XLOC_009978
TCONS_00019861 mRNA upstream 164377 27383717 ~ 27405460 (+) False XLOC_009976
TCONS_00019877 mRNA downstream 22347 27593698 ~ 27602512 (+) True XLOC_009981
TCONS_00019878 mRNA downstream 32388 27603739 ~ 27609172 (+) False XLOC_009982
TCONS_00019879 mRNA downstream 32397 27603748 ~ 27609172 (+) True XLOC_009982
TCONS_00019880 mRNA downstream 43638 27614989 ~ 27622183 (+) True XLOC_009983
TCONS_00019881 mRNA downstream 386457 27957808 ~ 27998856 (+) True XLOC_009985
TCONS_00019873 other upstream 14597 27549842 ~ 27555240 (+) False XLOC_009979
TCONS_00019866 other upstream 14701 27543308 ~ 27555136 (+) False XLOC_009979
TCONS_00019869 other upstream 14735 27543582 ~ 27555102 (+) False XLOC_009979
TCONS_00019867 other upstream 14788 27543497 ~ 27555049 (+) False XLOC_009979
TCONS_00019870 other upstream 19481 27543588 ~ 27550356 (+) False XLOC_009979
TCONS_00019885 other downstream 816695 28388046 ~ 28388163 (+) True XLOC_009989
TCONS_00019905 other downstream 1445585 29016936 ~ 29019138 (+) True XLOC_010002
TCONS_00019912 other downstream 1644923 29216274 ~ 29216360 (+) True XLOC_010005
TCONS_00019938 other downstream 2431401 30002752 ~ 30036693 (+) False XLOC_010020
TCONS_00019939 other downstream 2509192 30080543 ~ 30080661 (+) True XLOC_010021

Expression Profile


//