RNA id: TCONS_00025450


Basic Information

Item Value
RNA id TCONS_00025450
length 773
RNA type mRNA
GC content 0.46
exon number 5
gene id XLOC_012746
representative False

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 18861359 ~ 18870632 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GACAAATACAGTTTTACTACTGCTCGAGTCATTGATCGCAATGCAAAAATGACTGTTGTGCAGTGACATTTTCATAAAATCAACTTATTTTATACTGAGAAGAAATGGCGGATTTTCCTGGGAAGGTCAGCACTCAGACCAGCTCACAAGAGCCTCAGAGAAGTTTTGCAATCTCATCAAGTGTTGACATGGGTTTTATCAAGAGCATTCCTGGAATACTGCTTATAGCCGAGATCGTTGTTGGATTATTAGTGTGGACGCTGATTGCCAGTACTCCCCATTACTTGATACCTGCTTTAGGCTGGGTGTTGTTTGTGAGCATTACTCTGTGGCTTCTGAGCATTGCCCTGCTGGTTATCCTGTTGCTGAGTCTTCATCAGCGGTTACCCTCGGTGCCCTGGCCTTTGGTGCTGTTGGTATTCTATTCTGTCGCAGCTCTTTTGTATCTCACTGCCTTTCTGGCTAATGCTGCAACTGTTCCTGGTGGGTATTACCAGGGTCATCTAGGAGCCTCTGCGTTCTTTGGTATAGTGGAGACCCTGTTATACACAGCCAGCAGCTACTTTGCCTATTTGGGCTGGAGGGGTGAAGGGCAGAACGCAGCAGGGAGCACGGTGCCCGTGTAGAGCATCTCATCGTCTGGATAACACTCACATTCTCTGTATGAGAACACTTGGAAGAGGATTATTACTCAGGTTATTGCTGAAACTCATCTTCGGTGATGTCTGACAGTCTTAATGGTGCAAAGCGTAATTGCTATGGTTTATAACATG

Function

GO:

id name namespace
GO:0030100 regulation of endocytosis biological_process
GO:0048546 digestive tract morphogenesis biological_process
GO:0042552 myelination biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0019911 structural constituent of myelin sheath molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050419-195 Predicted to be a structural constituent of myelin sheath. Acts upstream of or within digestive tract morphogenesis and regulation of endocytosis. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in hatching gland; mid intestine; and pronephric duct. Orthologous to human PLLP (plasmolipin).

Ensembl:

ensembl_id ENSDART00000144605

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00026893 lncRNA upstream 33262 18827219 ~ 18828097 (+) False XLOC_012745
TCONS_00027097 lncRNA upstream 48451 18740827 ~ 18812908 (+) True XLOC_012743
TCONS_00026892 lncRNA upstream 61695 18798840 ~ 18799664 (+) False XLOC_012744
TCONS_00027096 lncRNA upstream 90465 18733177 ~ 18770894 (+) False XLOC_012742
TCONS_00026891 lncRNA upstream 90853 18769682 ~ 18770506 (+) False XLOC_012742
TCONS_00025453 lncRNA downstream 40082 18910366 ~ 18911261 (+) False XLOC_012748
TCONS_00027098 lncRNA downstream 40086 18910370 ~ 18911615 (+) True XLOC_012748
TCONS_00027099 lncRNA downstream 98606 18968890 ~ 18969766 (+) True XLOC_012749
TCONS_00025458 lncRNA downstream 155705 19025989 ~ 19033213 (+) True XLOC_012752
TCONS_00027100 lncRNA downstream 542813 19413097 ~ 19415810 (+) False XLOC_012756
TCONS_00025442 mRNA upstream 230277 18612388 ~ 18631082 (+) True XLOC_012738
TCONS_00025440 mRNA upstream 389102 18439332 ~ 18472257 (+) False XLOC_012737
TCONS_00025441 mRNA upstream 390430 18455029 ~ 18470929 (+) True XLOC_012737
TCONS_00025439 mRNA upstream 438816 18405992 ~ 18422543 (+) True XLOC_012736
TCONS_00025436 mRNA upstream 751327 18104235 ~ 18110032 (+) True XLOC_012733
TCONS_00025452 mRNA downstream 9449 18879733 ~ 18901017 (+) True XLOC_012747
TCONS_00025454 mRNA downstream 111793 18982077 ~ 18995283 (+) True XLOC_012750
TCONS_00025455 mRNA downstream 135779 19006063 ~ 19039960 (+) False XLOC_012751
TCONS_00025457 mRNA downstream 138276 19008560 ~ 19038957 (+) False XLOC_012751
TCONS_00025456 mRNA downstream 138276 19008560 ~ 19038957 (+) True XLOC_012751
TCONS_00025449 other upstream 32874 18827249 ~ 18828485 (+) True XLOC_012745
TCONS_00025448 other upstream 61307 18799118 ~ 18800052 (+) True XLOC_012744
TCONS_00025447 other upstream 90465 18770075 ~ 18770894 (+) True XLOC_012742
TCONS_00025446 other upstream 127000 18733425 ~ 18734359 (+) False XLOC_012742
TCONS_00025445 other upstream 135266 18725978 ~ 18726093 (+) True XLOC_012741
TCONS_00025461 other downstream 253048 19123332 ~ 19124079 (+) True XLOC_012754
TCONS_00025507 other downstream 2151415 21021699 ~ 21023601 (+) True XLOC_012781
TCONS_00025513 other downstream 2321381 21191665 ~ 21191784 (+) True XLOC_012787
TCONS_00025547 other downstream 4317135 23187419 ~ 23249572 (+) False XLOC_012803
TCONS_00025560 other downstream 4601862 23472146 ~ 23472260 (+) True XLOC_012806

Expression Profile

//