RNA id: TCONS_00030473


Basic Information

Item Value
RNA id TCONS_00030473
length 552
lncRNA type inter_gene
GC content 0.52
exon number 2
gene id XLOC_015166
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 4894856 ~ 4898290 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTGAGTTCATCTAAACCCCTACAGTGACGAAAACAGACCCGCTCAGCAGCGTGCCGAATACTCGATCTGGGACATTTGAAGCCTCAGAATGGTGTTGGGGCGGATATTTCACGCGTTAATAAACAACGCTCAGGTGGTGGAAAAACTGGCGGAGTCTCGACCCATCCGACGTGCAGCTCAGATCACGGCCTTCGCCATCACTAAAGCGCAGATCGCCGGCAGAGAGGCCTCCACAAAGCTGCTCCGCTCCGAAACTCTCCAGCAGATCCGCAAGGAGAGCGCACAGATGCCGGGAGACGTGCAGGAGTTGCGCCGCAGGGCCACCAGACTACGGGACACCTTCGTGAAGGAGGTCCGAGAGGGAGTGAGGGACGCAAACCGGCAGATTAAAGACAGAAAGTGACGGATGAAGTGCAATATGAGGACAGTGCCATTAAAGACTCCATGGAGAATGATCGATTTAAATGAGTGACACTGAAAACATGACGTTGATTCTGTGAATGAAAGTGCAATGATGTTTGAATGAAATAAAGTTGATCAAGGTTATGCCAC

Function

GO:

id name namespace
GO:0048513 animal organ development biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0048024 regulation of mRNA splicing, via spliceosome biological_process
GO:0008380 RNA splicing biological_process
GO:0044422 obsolete organelle part cellular_component
GO:0070013 intracellular organelle lumen cellular_component
GO:0044446 obsolete intracellular organelle part cellular_component
GO:0032991 protein-containing complex cellular_component
GO:0031974 membrane-enclosed lumen cellular_component
GO:0043229 intracellular organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043233 organelle lumen cellular_component

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00030459 lncRNA upstream 809435 4074412 ~ 4085421 (+) False XLOC_015160
TCONS_00030452 lncRNA upstream 1117510 3774742 ~ 3777346 (+) False XLOC_015156
TCONS_00033461 lncRNA upstream 1287455 3606030 ~ 3607401 (+) True XLOC_015155
TCONS_00033229 lncRNA upstream 1424843 3468101 ~ 3470013 (+) True XLOC_015149
TCONS_00033228 lncRNA upstream 1440689 3452813 ~ 3454167 (+) True XLOC_015148
TCONS_00030488 lncRNA downstream 828174 5726464 ~ 5729675 (+) False XLOC_015175
TCONS_00033230 lncRNA downstream 828412 5726702 ~ 5726906 (+) True XLOC_015175
TCONS_00033462 lncRNA downstream 832837 5731127 ~ 5736505 (+) True XLOC_015176
TCONS_00033463 lncRNA downstream 942818 5841108 ~ 5852829 (+) False XLOC_015178
TCONS_00033464 lncRNA downstream 1020960 5919250 ~ 5923388 (+) True XLOC_015179
TCONS_00030472 mRNA upstream 486038 4402765 ~ 4408818 (+) True XLOC_015165
TCONS_00030471 mRNA upstream 506853 4383061 ~ 4388003 (+) True XLOC_015164
TCONS_00030470 mRNA upstream 541048 4303181 ~ 4353808 (+) True XLOC_015163
TCONS_00030469 mRNA upstream 567123 4303125 ~ 4327733 (+) False XLOC_015163
TCONS_00030467 mRNA upstream 676969 4208323 ~ 4217887 (+) True XLOC_015161
TCONS_00030474 mRNA downstream 347402 5245692 ~ 5280718 (+) True XLOC_015167
TCONS_00030475 mRNA downstream 402115 5300405 ~ 5311253 (+) True XLOC_015168
TCONS_00030476 mRNA downstream 473202 5371492 ~ 5389688 (+) False XLOC_015169
TCONS_00030478 mRNA downstream 507946 5406236 ~ 5407872 (+) True XLOC_015170
TCONS_00030479 mRNA downstream 547797 5446087 ~ 5450198 (+) False XLOC_015171
TCONS_00030468 other upstream 606310 4281682 ~ 4288546 (+) True XLOC_015162
TCONS_00030445 other upstream 1326897 3565376 ~ 3567959 (+) True XLOC_015153
TCONS_00030434 other upstream 1719861 3174870 ~ 3174995 (+) True XLOC_015144
TCONS_00030432 other upstream 1872201 2994052 ~ 3022655 (+) True XLOC_015141
TCONS_00030431 other upstream 1900698 2994052 ~ 2994158 (+) False XLOC_015141
TCONS_00030477 other downstream 482568 5380858 ~ 5389696 (+) True XLOC_015169
TCONS_00030484 other downstream 689205 5587495 ~ 5677726 (+) False XLOC_015174
TCONS_00030485 other downstream 702753 5601043 ~ 5677644 (+) False XLOC_015174
TCONS_00030507 other downstream 1358157 6256447 ~ 6258795 (+) True XLOC_015187
TCONS_00030509 other downstream 1469412 6367702 ~ 6367816 (+) True XLOC_015189

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
tiger barb (Puntius tetrazona) TU14373 True 879 TUCP 0.36 2 NC_056700.1 5608327 ~ 5609276 (+)