RNA id: TCONS_00032018


Basic Information

Item Value
RNA id TCONS_00032018
length 226
lncRNA type retained_intron
GC content 0.38
exon number 2
gene id XLOC_016234
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 14207559 ~ 14272083 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCGGTTTGTGGAGACGATGCAATTTTTGTAGAATTGAAGATAGAGTTCTGTCGATTTCTCAGAAAAAATGTCTGATTTAGCAAAAGAGAAAGCACGTCTCCTGAAGAAGCGTGGAAGTTTGTCTTCTCTAGGCAGTCATGAAGTCAGAGCTATTGGCAAAACTAAAGAGTGAGTACTAATTCCTTCGTATAGCAAATCCCATAGTAGTATAAACGTCATTTGCTTT

Function

GO:

id name namespace
GO:0060271 cilium assembly biological_process
GO:0005575 cellular_component cellular_component
GO:0003674 molecular_function molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040912-49 Predicted to enable dynein intermediate chain binding activity. Acts upstream of or within cilium assembly. Predicted to be part of cytoplasmic dynein complex. Predicted to be active in cytoplasm. Orthologous to human DYNLT5 (dynein light chain Tctex-type family member 5).

Ensembl:

ensembl_id ENSDART00000164560

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00032015 lncRNA downstream 242555 14021956 ~ 14029161 (-) True XLOC_016233
TCONS_00032014 lncRNA downstream 261058 14009630 ~ 14010658 (-) True XLOC_016232
TCONS_00032013 lncRNA downstream 262188 14007938 ~ 14009528 (-) True XLOC_016231
TCONS_00033789 lncRNA downstream 266774 14002395 ~ 14004942 (-) True XLOC_016230
TCONS_00033353 lncRNA downstream 394195 13875695 ~ 13877521 (-) True XLOC_016228
TCONS_00032023 lncRNA upstream 122045 14394120 ~ 14426667 (-) True XLOC_016236
TCONS_00033790 lncRNA upstream 166910 14438985 ~ 14440380 (-) True XLOC_016237
TCONS_00032026 lncRNA upstream 217867 14489942 ~ 14491843 (-) True XLOC_016239
TCONS_00033354 lncRNA upstream 242091 14514166 ~ 14515594 (-) False XLOC_016240
TCONS_00033355 lncRNA upstream 242462 14514537 ~ 14515392 (-) False XLOC_016240
TCONS_00032012 mRNA downstream 384874 13885155 ~ 13886842 (-) True XLOC_016229
TCONS_00032004 mRNA downstream 579882 13688624 ~ 13691834 (-) True XLOC_016226
TCONS_00032003 mRNA downstream 888990 13376099 ~ 13382726 (-) True XLOC_016223
TCONS_00032001 mRNA downstream 937725 13257124 ~ 13333991 (-) False XLOC_016222
TCONS_00032019 mRNA upstream 4564 14276639 ~ 14390627 (-) False XLOC_016235
TCONS_00032020 mRNA upstream 6766 14278841 ~ 14387335 (-) False XLOC_016235
TCONS_00032022 mRNA upstream 6823 14278898 ~ 14387335 (-) False XLOC_016235
TCONS_00032021 mRNA upstream 6823 14278898 ~ 14387335 (-) True XLOC_016235
TCONS_00032024 mRNA upstream 172201 14444276 ~ 14571577 (-) False XLOC_016238
TCONS_00031998 other downstream 1016919 13252152 ~ 13254797 (-) True XLOC_016221
TCONS_00031991 other downstream 2047177 12224423 ~ 12224539 (-) True XLOC_016216
TCONS_00031983 other downstream 2608793 11656553 ~ 11662923 (-) True XLOC_016210
TCONS_00031958 other downstream 3366537 10905062 ~ 10905179 (-) True XLOC_016199
TCONS_00031915 other downstream 4524285 9747302 ~ 9747431 (-) True XLOC_016178
TCONS_00032033 other upstream 722318 14994393 ~ 14994490 (-) True XLOC_016250
TCONS_00032037 other upstream 756571 15028646 ~ 15033121 (-) True XLOC_016251
TCONS_00032040 other upstream 830028 15102103 ~ 15107716 (-) True XLOC_016253
TCONS_00032063 other upstream 2236749 16508824 ~ 16512422 (-) True XLOC_016264
TCONS_00032069 other upstream 2343865 16615940 ~ 16616055 (-) True XLOC_016267

Expression Profile

//