RNA id: TU13346


Basic Information

Item Value
RNA id TU13346
length 416
RNA type TUCP
GC content 0.65
exon number 2
gene id G8913
representative True

Chromosome Information

Item Value
chromosome id NC_056700.1
NCBI id CM032069.1
chromosome length 25613461
location 2442184 ~ 2443319 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence

GCTTAAAGATGACTTCATCATAGCCACCCTCAACACAGCCACATACTTACAGATGGAGCACGTGATGGACACATGCCAGAGGTTCATAGACTCCAGGGGCTTGTGTGTAAAGCAGACCAGAACAGAGGTGCTGATCAGTCACGGCTGTTTATCCTCAGAAGCTCCCTTCCTCCTCAGCGATGCCCTGAACAGCCAGTCCAGGGTCAGCTTCGGCACTTACGCTCCTCCGAACACGCACTATGCCGTTAGCACTTCCACCGAAAGCCCCGCTCGCTTCTACAGACCTCTACCTCTCAACGTGGACACGCCGAACCCGCTCTGGCGGATCCCTAAGAGCGGCGTGATGCTCCGCCAGCAGCAGTCCCCGCGGACGCCGGAGCCTCGGCTCGGACCGTCGCCGACGCAGAAGCCCCGGG

Function

GO:

id name namespace
GO:0009615 response to virus biological_process
GO:0051090 regulation of DNA-binding transcription factor activity biological_process

KEGG:

id description
ko04668 TNF signaling pathway
ko04658 Th1 and Th2 cell differentiation
ko04380 Osteoclast differentiation

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU13297 lncRNA downstream 41587 2348072 ~ 2400597 (-) True G8889
TU13279 lncRNA downstream 141168 2298796 ~ 2301016 (-) False insl5b
TU13263 lncRNA downstream 211891 2229822 ~ 2230293 (-) True G8862
TU13260 lncRNA downstream 221346 2219948 ~ 2220838 (-) True G8859
TU13257 lncRNA downstream 226356 2215433 ~ 2215828 (-) True G8856
TU13355 lncRNA upstream 23568 2466887 ~ 2468236 (-) True G8919
TU13356 lncRNA upstream 23568 2466887 ~ 2468236 (-) False G8919
TU13378 lncRNA upstream 81574 2524893 ~ 2581281 (-) True G8929
TU13322 lncRNA upstream 148308 2591627 ~ 2593011 (-) False anxa13l
TU13419 lncRNA upstream 203576 2646895 ~ 2647796 (-) True G8949
XM_043219833.1 mRNA downstream 140824 2298870 ~ 2301360 (-) True insl5b
XM_043257903.1 mRNA downstream 237802 2189510 ~ 2204382 (-) True LOC122358118
XM_043253625.1 mRNA downstream 272863 2158449 ~ 2169321 (-) False LOC122355393
XM_043253616.1 mRNA downstream 272864 2158449 ~ 2169320 (-) True LOC122355393
XM_043253388.1 mRNA downstream 360684 2075896 ~ 2081500 (-) True LOC122355284
XM_043258567.1 mRNA upstream 17990 2461309 ~ 2465921 (-) True LOC122358726
XM_043258655.1 mRNA upstream 68288 2511607 ~ 2517254 (-) True LOC122358781
XM_043258584.1 mRNA upstream 74396 2517715 ~ 2519534 (-) True LOC122358747
XM_043258602.1 mRNA upstream 74396 2517715 ~ 2519099 (-) False LOC122358747
XM_043258593.1 mRNA upstream 74722 2518041 ~ 2519661 (-) False LOC122358747
TU13282 other downstream 471 2439361 ~ 2441713 (-) False G8880
TU13285 other downstream 471 2440124 ~ 2441713 (-) True G8880
XR_006247870.1 other downstream 1057018 1385097 ~ 1385166 (-) True LOC122328981
XR_006247864.1 other downstream 1057309 1384697 ~ 1384875 (-) True LOC122328955
XR_006247866.1 other downstream 1057909 1384090 ~ 1384275 (-) True LOC122328960
TU13363 other upstream 33394 2476713 ~ 2502739 (-) True G8921
TU13373 other upstream 73460 2516779 ~ 2517260 (-) False LOC122358781
TU13381 other upstream 88517 2531836 ~ 2540982 (-) True G8931
XR_006253024.1 other upstream 342439 2785758 ~ 2813482 (-) True prkag2b
TU13612 other upstream 715515 3158834 ~ 3164824 (-) True G9089

Expression Profile