Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU2678268

Basic Information

Item	Value
RNA id	TU2678268
length	220
lncRNA type	inter_gene
GC content	0.46
exon number	1
gene id	G2339327
representative	True

Chromosome Information

Item	Value
chromosome id	NW_023493665.1
NCBI id	JAAXML020000242.1
chromosome length	1484196
location	48224 ~ 48443 (+)
genome version	USDA_OmykA_1.1_2020_rainbow_trout_Genome
species	rainbow trout (Oncorhynchus mykiss)

Sequence

ttatggatccccattatttcctgtcaaggcagcagctactcttcctggggtttattatggatccccattagttcctgtcaaggcagcagctactcttcctgaggtttattatggatccccattagttcctgccaaggcagcagctactcttcctggggtttattatggatccccattagttcctgccaaagcagcagctactcttccttgggtttattat

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU2678264	lncRNA	upstream	7530	40477 ~ 40694 (+)	True	G2339323
TU2678261	lncRNA	upstream	21869	25589 ~ 26355 (+)	True	G2339320
TU2678257	lncRNA	upstream	28283	19335 ~ 19941 (+)	True	G2339319
TU2678256	lncRNA	upstream	29046	18949 ~ 19178 (+)	True	G2339318
TU2678271	lncRNA	downstream	8408	56851 ~ 57090 (+)	True	G2339330
TU2678276	lncRNA	downstream	29746	78189 ~ 78507 (+)	True	G2339334
TU2678281	lncRNA	downstream	36622	85065 ~ 85395 (+)	True	G2339339
TU2678286	lncRNA	downstream	50077	98520 ~ 99492 (+)	True	G2339344
TU2678295	lncRNA	downstream	63635	112078 ~ 115154 (+)	True	G2339352
XM_036972373.1	mRNA	downstream	58626	107069 ~ 305241 (+)	False	LOC118947131
XM_036972374.1	mRNA	downstream	58626	107069 ~ 305241 (+)	True	LOC118947131
XR_005041782.1	mRNA	downstream	547060	595503 ~ 596337 (+)	True	LOC118947129
XM_036972394.1	mRNA	downstream	714136	762579 ~ 768787 (+)	True	LOC110495334
XM_036972370.1	mRNA	downstream	763044	811487 ~ 817121 (+)	False	si:ch73-41e3.7
TU2678285	other	downstream	48672	97115 ~ 97856 (+)	True	G2339343
TU2678479	other	downstream	414755	463198 ~ 464467 (+)	True	G2339478
TU2678903	other	downstream	634901	683344 ~ 685548 (+)	True	G2339795
TU2679051	other	downstream	822664	871107 ~ 873839 (+)	False	G2339912
TU2679060	other	downstream	822664	871107 ~ 873839 (+)	False	G2339912

Expression Profile