CI01000057_05955545_05960873 (EDN3)


Basic Information

Item Value
gene id CI01000057_05955545_05960873
gene name EDN3
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 5955538 ~ 5961098 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000057_05955545_05960873.mRNA
AACTAATACCATCTGCTGCAGAAACCCGAGGATGCTTTTCTGTCGCGCTCCGCTCTTCTGGCACCCCGCAAATCTGAAACAAATGACAGACTGCTGCATCCACGTGGGAATAAAAGAGTAACGAACAAAATGATACTTTTAACTGCAGTTGGATCACTCAGCACTTCTGGTCAATCCTGGATTTTAAACTGATCTTTTTCACGGAGACTATCTGGAATAACTGGGATGGCCAATGTGTCATTAATACATTTGGGAATTTTGCTTTTTATTGGACTAACAGTCGCAATGGCCAACGATGCGCTTGTGAAAAACAAGGCGAAGGATTTAATTAAAGTATCAAGTGCGACTCCTAAGCAGTTTGGTGATTCTGCTAATAAACCTGGAGCGTGTTATTTCTGCCAGCTCCTAAAACCACGGAGGAGAGCCAAGAGATGCACATGTTACACCTACAAAGACAAGGAGTGTGTTTACTACTGTCACCTGGACATCATCTGGATCAACACACCAGAGCGCACTGTCCCATATGGCATGTCAAGTTATAGAGGCTCCCAGCGGGTACGGCGTTCTGCTGAGGGCAGCGTAGGAGGTCAGCGCTGCGCGTGTGCTTTACACAGCGACCAAGAGTGCACCACTTTCTGCAGTCAGAGGTAATAATAAA

Function

symbol description
edn3 Enables endothelin B receptor binding activity and hormone activity. Involved in several processes, including neutrophil chemotaxis; positive regulation of cell communication; and vein smooth muscle contraction. Acts upstream of or within positive regulation of cell differentiation; positive regulation of cell population proliferation; and regulation of gene expression. Located in extracellular space. Implicated in Hirschsprung's disease; Waardenburg syndrome type 4B; Waardenburg's syndrome; and congenital central hypoventilation syndrome.

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000057_05955545_05960873.mRNA True 658 mRNA 0.46 3 5955538 5961098

Neighbor

gene id symbol gene type direction distance location
CI01000057_05925181_05926068 NA coding downstream 28243 5923540 ~ 5927295 (-)
CI01000057_05857113_05861024 ACOT8 coding downstream 93059 5856980 ~ 5862479 (-)
CI01000057_05849700_05856513 SRSF6 coding downstream 99025 5849106 ~ 5856513 (-)
CI01000057_05842522_05847302 IFT52 coding downstream 108236 5842319 ~ 5847302 (-)
CI01000057_05830634_05838724 MYBL2, MYBL2B coding downstream 116491 5830058 ~ 5839047 (-)
CI01000057_05989326_06003691 NA coding upstream 27671 5988769 ~ 6004299 (-)
G247075 NA non-coding downstream 5509 5949824 ~ 5950029 (-)
G247070 NA non-coding downstream 15093 5940218 ~ 5940445 (-)
G247068 NA non-coding downstream 48215 5907081 ~ 5907323 (-)
G247067 NA non-coding downstream 49377 5905856 ~ 5906161 (-)
G247065 NA non-coding downstream 51382 5903936 ~ 5904156 (-)
G247091 NA non-coding upstream 6379 5967477 ~ 5967783 (-)
G247079 NA non-coding upstream 6738 5967836 ~ 5968234 (-)
G247092 NA non-coding upstream 7490 5968588 ~ 5968798 (-)
G247093 NA non-coding upstream 7753 5968851 ~ 5969218 (-)
G247098 NA non-coding upstream 14194 5975292 ~ 5975583 (-)
G246780 NA other downstream 671921 5086312 ~ 5283617 (-)
CI01000057_04927533_04931127 CDK4 other downstream 1024118 4927533 ~ 4931420 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 other downstream 2057847 3887203 ~ 3892054 (-)
CI01000057_01904867_01921400 NA other downstream 4034117 1904533 ~ 1921905 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_003789 CR855375.5 coding NC_007122.7 CM002895.2 394493 ~ 396724 (-)