G289209


Basic Information

Item Value
gene id G289209
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000075
NCBI id null
chromosome length 1642109
location 872419 ~ 872683 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU328011
CCTCAGTTATTAAGACAGAAATGTCAACAACCATGGAAAACTCAAATAATTAAAATGTTGTGCGGTGTTGCAGCTACAGATGTTGTTGGTTGAATACGGCTGTGCTCCAAAGGGTGAGCGCGGCTAAGGTGGTACATCAAGTTCGTGGTATTACCAGTCTTGCATAATTTGCAGACGACATTGGTCTGACTACGGTCAGACTTATAATATCCAAAAAACTGCCATACTGGCGAGCTGACATTTCCTCTTTTATTTACAATTTCCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU328011 True 265 lncRNA 0.41 1 872419 872683

Neighbor

gene id symbol gene type direction distance location
CI01000075_00749894_00757773 NA coding downstream 113864 749842 ~ 758555 (-)
CI01000075_00686719_00747700 PIEZO2 coding downstream 124719 685131 ~ 747700 (-)
CI01000075_00649702_00654404 NA coding downstream 217815 646532 ~ 654604 (-)
CI01000075_00636212_00641437 MTCL1 coding downstream 230982 635984 ~ 641437 (-)
CI01000075_00582299_00626751 MTCL1 coding downstream 244565 582060 ~ 627854 (-)
CI01000075_00885681_00895778 RANBP3B coding upstream 12744 883956 ~ 895778 (-)
CI01000075_00952466_00992777 CTNNBL1 coding upstream 79456 952139 ~ 992777 (-)
CI01000075_01161238_01161465 NA coding upstream 288509 1161192 ~ 1161465 (-)
CI01000075_01166008_01203828 NA coding upstream 292269 1164952 ~ 1203828 (-)
CI01000075_01206857_01230864 NA coding upstream 334174 1206857 ~ 1230864 (-)
G289175 NA non-coding downstream 68020 800876 ~ 804399 (-)
G289161 NA non-coding downstream 179611 692516 ~ 692808 (-)
G289155 NA non-coding downstream 195188 675289 ~ 677231 (-)
G289148 NA non-coding downstream 207146 664946 ~ 665273 (-)
G289101 NA non-coding downstream 211474 655859 ~ 660945 (-)
G289216 NA non-coding upstream 41003 913686 ~ 914104 (-)
G289218 NA non-coding upstream 49893 922576 ~ 922816 (-)
G289183 NA non-coding upstream 68011 940694 ~ 941050 (-)
G289244 NA non-coding upstream 131703 1004386 ~ 1004694 (-)
G289167 NA other downstream 84020 770094 ~ 788399 (-)
CI01000075_00307523_00328194 NA other downstream 544102 307523 ~ 331562 (-)
CI01000075_00275752_00278496 NA other downstream 593879 275238 ~ 278542 (-)
G289036 NA other downstream 757814 108703 ~ 114605 (-)
CI01000075_00022145_00044289 NA other downstream 816655 20947 ~ 44289 (-)
G289427 NA other upstream 619640 1492323 ~ 1515938 (-)

Expression


Co-expression Network