G328734


Basic Information

Item Value
gene id G328734
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000112
NCBI id null
chromosome length 5247617
location 1554743 ~ 1555364 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU373643
TCCATAAATAATTCACATCTGTTCTTTGCAAGCAGTGTTTCCTCCCCCACCCCCACAGTAGTAGTTTAATTTGATATGAACTTAGAAGTCAACATGAAACCAAAACTGTCCCTAATTATGTAATATGCATTGCTGGTCTTAGAAAATGTCCAATGAAAGTCTTTGCAATCTTTTATCAAAACATAATAACATTCTCCGCCTCTGAAATGACTTTTCAGTCAATGTCACAGAGGCTGTGAAGGCTACTGGTTAACCTTTCAGCTTCAGACACACAAATTCCTGAGCCTTCAATTTTATTGTCAAGAACATGTTCCAAAACAAAACCAATGCGGTGTCAGATTTTGTATGTGTGGGGTCAACAGTCTTTTAGGTGATTTCTACAGCACATTAATGGCCTATAGCTTTTTATTTACTTCTTTATTTTTTAGCTGTGAATTCAAAGCATTCAAAGATAAGAATGGTCACTGGATCTGGTAACACTTTATTTTAAGGTGACACTTGCACATCTTACATGTACTTACTATAGTAAGAACAGTATATTACAAGCAACTAACCCTAAACCAAATCCTGACCCTTAAGCACATTTATTAATATTACTCAGTACATATTTGTGTAGTTACAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU373643 True 622 lncRNA 0.35 1 1554743 1555364

Neighbor

gene id symbol gene type direction distance location
CI01000112_01517833_01520418 NA coding downstream 34197 1517728 ~ 1520546 (-)
CI01000112_01486968_01488917 NA coding downstream 65242 1485371 ~ 1489501 (-)
CI01000112_01437714_01440420 NA coding downstream 114235 1437457 ~ 1440508 (-)
CI01000112_01367862_01375489 NA coding downstream 177369 1367451 ~ 1377374 (-)
CI01000112_01324078_01345821 SEPT9, SEPT9A, SEPT9B coding downstream 208922 1324078 ~ 1345821 (-)
CI01000112_01772132_01776695 PRPSAP1 coding upstream 216383 1771747 ~ 1776853 (-)
CI01000112_01953215_01962043 NA coding upstream 397794 1953158 ~ 1962751 (-)
CI01000112_01967374_01971965 NA coding upstream 411694 1967058 ~ 1971965 (-)
CI01000112_01999128_02000283 NA coding upstream 443755 1999119 ~ 2000283 (-)
CI01000112_02000588_02006313 NA coding upstream 445163 2000527 ~ 2007133 (-)
G328702 NA non-coding downstream 42369 1511807 ~ 1512374 (-)
G328705 NA non-coding downstream 44295 1509143 ~ 1510448 (-)
G328726 NA non-coding downstream 46620 1507917 ~ 1508123 (-)
G328724 NA non-coding downstream 49978 1504190 ~ 1504765 (-)
G328719 NA non-coding downstream 56325 1497768 ~ 1498418 (-)
G328735 NA non-coding upstream 1880 1557244 ~ 1557484 (-)
G328736 NA non-coding upstream 3257 1558621 ~ 1558822 (-)
G328737 NA non-coding upstream 4205 1559569 ~ 1559884 (-)
G328738 NA non-coding upstream 17002 1572366 ~ 1572589 (-)
G328772 NA non-coding upstream 70076 1625440 ~ 1626103 (-)
G328642 NA other downstream 267785 1286655 ~ 1286958 (-)
G328641 NA other downstream 268219 1286092 ~ 1286524 (-)
CI01000112_00810157_00821637 TRIM25 other downstream 686107 808545 ~ 821932 (-)
CI01000112_00792970_00793455 CQ067, CLG09H17ORF67, C9H17ORF67 other downstream 759797 792271 ~ 793455 (-)
G328332 NA other downstream 772959 780164 ~ 781784 (-)
G329587 NA other upstream 74412 1629776 ~ 1633322 (-)
G329559 NA other upstream 242652 1791084 ~ 1809739 (-)
G329569 NA other upstream 436302 1991666 ~ 1997859 (-)
G329672 NA other upstream 461340 2016704 ~ 2019453 (-)
CI01000112_03068505_03072256 NA other upstream 1511956 3067320 ~ 3072879 (-)

Expression


Co-expression Network