Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G363076

Basic Information

Item	Value
gene id	G363076
gene name	NA
gene type	non-coding
species	grasscarp (Ctenopharyngodon idella)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	CI01000158
NCBI id	null
chromosome length	1938735
location	53936 ~ 54169 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU414151
CACAAATATAAAATATATACAATAAAAAACAAAAAGTACAATCCATATACTGTGCAGGCAGAGGCAGAAAACCCAAAAGGGCTTATTTAAAGCCTCCACCTAAACAACAACGACAAAAAGAAACTAATTGTGAAATCTATAGGTCTACTATAATTAAGACATTTATTCAGGAAATTCATTACAATCAGAAAGACGTATAGTACAGAGAAATTTCATGTCGGAGTAGGATTTGAG

Function

GO: NA

KEGG: NA

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU414151	True	234	lncRNA	0.32	1	53936	54169

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
CI01000158_00047164_00048174	NA	coding	downstream	5583	46972 ~ 48353 (-)
CI01000158_00038644_00043001	NA	coding	downstream	10908	38071 ~ 43028 (-)
CI01000158_00036387_00037400	NA	coding	downstream	16509	35917 ~ 37427 (-)
CI01000158_00029380_00034355	TAAR20T	coding	downstream	19221	28837 ~ 34715 (-)
CI01000158_00017507_00018520	NA	coding	downstream	35389	17011 ~ 18547 (-)
CI01000158_00102003_00103016	NA	coding	upstream	47683	101852 ~ 103043 (-)
CI01000158_00113468_00114478	NA	coding	upstream	58822	112991 ~ 114505 (-)
CI01000158_00129735_00137154	NA	coding	upstream	75013	129182 ~ 137211 (-)
CI01000158_00161749_00163076	NA	coding	upstream	106818	160987 ~ 163158 (-)
CI01000158_00176124_00177494	NA	coding	upstream	120087	174256 ~ 177778 (-)
G363084	NA	non-coding	upstream	8901	63070 ~ 63299 (-)
G363094	NA	non-coding	upstream	27680	81849 ~ 82094 (-)
G363101	NA	non-coding	upstream	44086	98255 ~ 99217 (-)
G363106	NA	non-coding	upstream	50733	104902 ~ 105200 (-)
G363807	NA	non-coding	upstream	191580	245749 ~ 246055 (-)
CI01000158_00286848_00307666	NA	other	upstream	243610	286545 ~ 307666 (-)
CI01000158_00717478_00721819	STAMBPA, STAMBP	other	upstream	665877	717291 ~ 722084 (-)
G364103	NA	other	upstream	1401965	1452257 ~ 1501547 (-)
G364203	NA	other	upstream	1633797	1687966 ~ 1688828 (-)

Expression

Co-expression Network