G363818


Basic Information

Item Value
gene id G363818
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000158
NCBI id null
chromosome length 1938735
location 316788 ~ 317127 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU414964
ATTATCACGCAAAAGCTGTTGTATGTAAGCTGTGCACCAACATCATTTGTGTAAAGAAGGTGCTAAATTTATGTGCTACTTGCCAAACTAAGTGTTGTAGTACCTAACCAGCCTCCTGTGATGTATGAACTAAATTTGGTGACAGTACAGTGTGTTACAGTGAAGTTATTGAGTATTTTTCATAATATAAAATGAGCAAAAGGGTTTTGGGTTTTGCACTTTTCAGACGGTCCCTTCAGACGTGTATCCCCGCCGCCTGCTCATAGAGACCAATTTATTATAAAGCACATTTGAGGAAAATTGGGTTGTTGTAGCTTGTTGTCTAGGTTACTGTGATTGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU414964 True 340 lncRNA 0.39 1 316788 317127

Neighbor

gene id symbol gene type direction distance location
CI01000158_00286848_00307666 NA coding downstream 9122 286545 ~ 307666 (-)
CI01000158_00234248_00237084 NPFFR1L1 coding downstream 79704 233777 ~ 237084 (-)
CI01000158_00199362_00223636 BMP1B, BMP1A, BMP1 coding downstream 93152 198857 ~ 223636 (-)
CI01000158_00184403_00186141 PCNA, MGC53867, PCNA.L coding downstream 129525 183997 ~ 187263 (-)
CI01000158_00176124_00177494 NA coding downstream 139010 174256 ~ 177778 (-)
CI01000158_00372066_00382393 NA coding upstream 54818 371945 ~ 382393 (-)
CI01000158_00387142_00400130 RAB11FIP1B coding upstream 70015 387142 ~ 400130 (-)
CI01000158_00409330_00422508 GPAT4, PLCF coding upstream 92006 409133 ~ 422627 (-)
CI01000158_00430123_00437063 CABP1 coding upstream 112904 430031 ~ 437063 (-)
CI01000158_00453940_00462329 NA coding upstream 136317 453444 ~ 462409 (-)
G363771 NA non-coding downstream 24604 291629 ~ 292184 (-)
G363766 NA non-coding downstream 41115 272085 ~ 275673 (-)
G363807 NA non-coding downstream 70733 245749 ~ 246055 (-)
G363106 NA non-coding downstream 211588 104902 ~ 105200 (-)
G363819 NA non-coding upstream 13186 330313 ~ 330527 (-)
G363829 NA non-coding upstream 37915 355042 ~ 355296 (-)
G363831 NA non-coding upstream 44206 361333 ~ 361593 (-)
G363832 NA non-coding upstream 52250 369377 ~ 370365 (-)
G363844 NA non-coding upstream 162834 479961 ~ 480422 (-)
CI01000158_00717478_00721819 STAMBPA, STAMBP other upstream 402919 717291 ~ 722084 (-)
G364103 NA other upstream 1139007 1452257 ~ 1501547 (-)
G364203 NA other upstream 1370839 1687966 ~ 1688828 (-)

Expression


Co-expression Network