G363831



Basic Information


Item Value
gene id G363831
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000158
NCBI id null
chromosome length 1938735
location 361333 ~ 361593 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU414986
CTAAGATTTAAAATATTCCTGTTTCTGAGAAGTCTGTGAATGCACCTTTTCTCCGGTGCTCGCCGATCGGTGTCTCCAAACGAAGCGCCGGTGAGCATATGACGTGCAGCGCTTCGGCTCCGAGAAGCAAACCACACATAAATCAGCGAGAGACTGAATGTGCTGCAGTAACAAGTGTTTCACAACTGTCACTCACTTACTCGTGCAAACCGATGCCCAACTTCTGTCGCCATGTCAGAACACCGTTCTGCGGGTGCGAAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU414986 True 261 lncRNA 0.50 1 361333 361593

Neighbor


gene id symbol gene type direction distance location
CI01000158_00286848_00307666 NA coding downstream 53667 286545 ~ 307666 (-)
CI01000158_00234248_00237084 NPFFR1L1 coding downstream 124249 233777 ~ 237084 (-)
CI01000158_00199362_00223636 BMP1B, BMP1A, BMP1 coding downstream 137697 198857 ~ 223636 (-)
CI01000158_00184403_00186141 PCNA, MGC53867, PCNA.L coding downstream 174070 183997 ~ 187263 (-)
CI01000158_00176124_00177494 NA coding downstream 183555 174256 ~ 177778 (-)
CI01000158_00372066_00382393 NA coding upstream 10352 371945 ~ 382393 (-)
CI01000158_00387142_00400130 RAB11FIP1B coding upstream 25549 387142 ~ 400130 (-)
CI01000158_00409330_00422508 GPAT4, PLCF coding upstream 47540 409133 ~ 422627 (-)
CI01000158_00430123_00437063 CABP1 coding upstream 68438 430031 ~ 437063 (-)
CI01000158_00453940_00462329 NA coding upstream 91851 453444 ~ 462409 (-)
G363829 NA non-coding downstream 6037 355042 ~ 355296 (-)
G363819 NA non-coding downstream 30806 330313 ~ 330527 (-)
G363818 NA non-coding downstream 44206 316788 ~ 317127 (-)
G363771 NA non-coding downstream 69149 291629 ~ 292184 (-)
G363832 NA non-coding upstream 7784 369377 ~ 370365 (-)
G363844 NA non-coding upstream 118368 479961 ~ 480422 (-)
G363775 NA non-coding upstream 154594 516187 ~ 516652 (-)
G363858 NA non-coding upstream 157093 518686 ~ 519093 (-)
G363877 NA non-coding upstream 214598 576191 ~ 576390 (-)
CI01000158_00717478_00721819 STAMBPA, STAMBP other upstream 358453 717291 ~ 722084 (-)
G364103 NA other upstream 1094541 1452257 ~ 1501547 (-)
G364203 NA other upstream 1326373 1687966 ~ 1688828 (-)

Expression



Co-expression Network