G412566


Basic Information

Item Value
gene id G412566
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000300
NCBI id null
chromosome length 11740502
location 6227080 ~ 6227290 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU473877
GTTTCTAGCATGTTATATGTTTGGCAACAGTTCTTCTAACCCTAACTGATGGAGTGTGTAGGTTTTTATTTCTTAAACAACCATGTAGAAAGACACATCATGGCCATATTCCAGGATGACACCGCTATGATTCATCAGGCTCAAATTGTGAAAGAATTATTGTTGTGAGAGAGCATAAAGAATCATTTTCACTCAAGAATTGGCTCTAGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU473877 True 211 lncRNA 0.37 1 6227080 6227290

Neighbor

gene id symbol gene type direction distance location
CI01000300_06039087_06039798 NA coding downstream 186210 6038932 ~ 6040870 (-)
CI01000300_05982822_06013144 SORBS2A, SORBS2 coding downstream 213936 5982379 ~ 6013144 (-)
CI01000300_05966800_05976695 PDLIM3A, PDLIM3 coding downstream 250385 5966112 ~ 5976695 (-)
CI01000300_05962858_05963880 NA coding downstream 262954 5962834 ~ 5964126 (-)
CI01000300_05956128_05961938 UFSP2 coding downstream 265142 5956014 ~ 5961938 (-)
CI01000300_06282739_06327586 MTNR1AA, MTNR1AB, MTNR1A coding upstream 55449 6282739 ~ 6327586 (-)
CI01000300_06347127_06393685 KLHL5 coding upstream 119647 6346937 ~ 6393685 (-)
CI01000300_06434048_06444297 FAM114A1 coding upstream 206399 6433689 ~ 6444297 (-)
CI01000300_06445229_06453282 NA coding upstream 217869 6445159 ~ 6453282 (-)
CI01000300_06557191_06577750 PGM2 coding upstream 329721 6557011 ~ 6578140 (-)
G412551 NA non-coding downstream 15219 6211653 ~ 6211861 (-)
G412550 NA non-coding downstream 17010 6209614 ~ 6210070 (-)
G412528 NA non-coding downstream 36619 6190011 ~ 6190461 (-)
G412521 NA non-coding downstream 42950 6183784 ~ 6184130 (-)
G412517 NA non-coding downstream 46970 6179702 ~ 6180110 (-)
G412571 NA non-coding upstream 2568 6229858 ~ 6230279 (-)
G412580 NA non-coding upstream 13325 6240615 ~ 6240949 (-)
G412584 NA non-coding upstream 18315 6245605 ~ 6245806 (-)
G412590 NA non-coding upstream 23050 6250340 ~ 6250633 (-)
G412604 NA non-coding upstream 37056 6264346 ~ 6264648 (-)
G412555 NA other downstream 11501 6214920 ~ 6215579 (-)
G412378 NA other downstream 465891 5711685 ~ 5761189 (-)
G411012 NA other downstream 1831959 4390320 ~ 4395121 (-)
CI01000300_04075307_04079312 NA other downstream 2144978 4074636 ~ 4080539 (-)
G410498 NA other downstream 2418873 3801139 ~ 3808207 (-)
G412681 NA other upstream 425708 6652998 ~ 6690333 (-)
G413140 NA other upstream 1919242 8146532 ~ 8146889 (-)
CI01000300_08959695_08973598 UGDH, UGDH.L other upstream 2742158 8958963 ~ 8973750 (-)
G414498 NA other upstream 3430759 9658049 ~ 9713722 (-)
CI01000300_10698449_10700497 NA other upstream 4468721 10696011 ~ 10701375 (-)

Expression


Co-expression Network