G431935


Basic Information

Item Value
gene id G431935
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 1915554 ~ 1921585 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU495963
TTCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCCGGGTTCGATTCCCGGTCAGGGAACACGCTTTTACCTTCCAGCGGCGGTCGCGATTGCGACGCGGCATGCTTCCAAAACTCAGGTGCGGCCAAGAAAGTGTTTGCGTGTGAAAAAGATCTCCTTCGAGCCGGAGTCGAACCAGCGACCTAAGGATTGCCAACTTCCCACCTACAGTCCTCCGCTCTACCAGCTGAGCTATCGAAGGCACACAGCTGGGGAAAGGAACCACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU495963 True 280 lncRNA 0.58 2 1915554 1921585

Neighbor

gene id symbol gene type direction distance location
CI01000306_01905901_01906725 NA coding downstream 8534 1905698 ~ 1907020 (-)
CI01000306_01859514_01870761 NA coding downstream 44732 1859005 ~ 1870822 (-)
CI01000306_01826418_01844251 MFN1B coding downstream 71303 1826097 ~ 1844251 (-)
CI01000306_01792788_01804803 ASPSCR1 coding downstream 110751 1792788 ~ 1804803 (-)
CI01000306_01775235_01776152 NA coding downstream 139122 1775197 ~ 1776432 (-)
CI01000306_01927392_02010649 FLNB coding upstream 5748 1927333 ~ 2010774 (-)
CI01000306_02022802_02080261 SLMAP, SLMAPA coding upstream 101217 2022802 ~ 2080261 (-)
CI01000306_02107105_02108186 ARF4B, ARF4 coding upstream 185309 2106894 ~ 2108266 (-)
CI01000306_02123270_02125888 PDE12 coding upstream 201131 2122716 ~ 2126015 (-)
CI01000306_02130408_02134817 ATP6AP1L, ATP6AP1LA coding upstream 208224 2129809 ~ 2134817 (-)
G431933 NA non-coding downstream 16447 1898865 ~ 1899107 (-)
G431751 NA non-coding downstream 17222 1856797 ~ 1898332 (-)
G431918 NA non-coding downstream 105495 1809843 ~ 1810059 (-)
G431916 NA non-coding downstream 108486 1806845 ~ 1807068 (-)
G431937 NA non-coding upstream 49873 1971458 ~ 1972195 (-)
G431949 NA non-coding upstream 181210 2102795 ~ 2105789 (-)
G431954 NA non-coding upstream 191064 2112649 ~ 2113064 (-)
G431710 NA non-coding upstream 220089 2141674 ~ 2142335 (-)
G431957 NA non-coding upstream 222057 2143642 ~ 2143870 (-)
CI01000306_01723684_01726043 MAFGA, MAFGB, MAFG other downstream 166604 1717933 ~ 1726043 (-)
G431814 NA other downstream 603120 1311702 ~ 1312434 (-)
G431706 NA other downstream 752216 1163027 ~ 1163338 (-)
CI01000306_00482506_00494090 PFKLB, PFKL other downstream 1431905 482482 ~ 494090 (-)
G432022 NA other upstream 1078651 3000236 ~ 3003891 (-)
CI01000306_04544349_04545034 NA other upstream 2621138 4542723 ~ 4545244 (-)
G433450 NA other upstream 3440058 5361643 ~ 5383763 (-)
G433670 NA other upstream 4119429 6041014 ~ 6041283 (-)
G433985 NA other upstream 4274522 6196107 ~ 6197210 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
eurasian perch (Perca fluviatilis) trnae-cuc_31 NA coding NC_053134.1 CM020931.1 2677463 ~ 2677534 (+)
striped catfish (Pangasianodon hypophthalmus) trnae-cuc_42 NA coding NC_047623.1 CM018569.1 3311361 ~ 3311432 (-)
tiger barb (Puntius tetrazona) trnar-ccu_47 NA misc NC_056707.1 CM032076.1 5443231 ~ 5443303 (+)
mexican tetra (Astyanax mexicanus) trnae-cuc_42 NA coding NW_019171900.1 APWO02001498.1 193345 ~ 193416 (+)
mexican tetra (Astyanax mexicanus) trnae-cuc_75 NA coding NW_019171913.1 APWO02001511.1 1170 ~ 1241 (+)