G467018


Basic Information

Item Value
gene id G467018
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000325
NCBI id null
chromosome length 10587162
location 5936441 ~ 5936663 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU536029
TTCCAAAAAAGTTGGGACACTGTACAAATTGTGAATAAAAAAGGAATGCAGTGATGTGGAAGTTTCAAATTTCAATATTTTATTCAGAATACAACATAGATGACATATCAAATGTTTAAACTGAGAAAATGTATCATTTTAAGGGAAAAATAAGTTGATTTTAAATTTCATGGCATCAACACATCTCAAAAAAGTTGGGACAAGGCTATGTTTACCACTGTGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU536029 True 223 lncRNA 0.30 1 5936441 5936663

Neighbor

gene id symbol gene type direction distance location
CI01000325_05787773_05791837 PRPH2L coding downstream 144604 5787603 ~ 5791837 (-)
CI01000325_05782613_05785408 SERPINA10A coding downstream 150493 5782214 ~ 5785948 (-)
CI01000325_05746064_05750106 NA coding downstream 186335 5746064 ~ 5750106 (-)
CI01000325_05706302_05715899 NA coding downstream 220542 5706201 ~ 5715899 (-)
CI01000325_05572394_05599826 BTBD7 coding downstream 336615 5572382 ~ 5599826 (-)
CI01000325_05968651_05972436 ZBTB25 coding upstream 30325 5966988 ~ 5972833 (-)
CI01000325_05991862_05992674 INAFM2 coding upstream 53464 5990127 ~ 5992733 (-)
CI01000325_06064671_06069495 NA coding upstream 127168 6063831 ~ 6069640 (-)
CI01000325_06279333_06313435 INO80 coding upstream 341571 6278234 ~ 6313506 (-)
CI01000325_06316580_06324054 VPS18 coding upstream 379716 6316379 ~ 6324054 (-)
G467017 NA non-coding downstream 479 5935612 ~ 5935962 (-)
G465923 NA non-coding downstream 42709 5893456 ~ 5893732 (-)
G465862 NA non-coding downstream 166336 5768255 ~ 5770105 (-)
G465851 NA non-coding downstream 180968 5753958 ~ 5755473 (-)
G467025 NA non-coding upstream 9820 5946483 ~ 5946999 (-)
G467023 NA non-coding upstream 12001 5948664 ~ 5949003 (-)
G467069 NA non-coding upstream 149058 6085721 ~ 6085952 (-)
G467071 NA non-coding upstream 154310 6090973 ~ 6091233 (-)
G467074 NA non-coding upstream 163929 6100592 ~ 6100845 (-)
G465716 NA other downstream 308273 5626213 ~ 5628168 (-)
CI01000325_05531464_05543064 ITPK1A other downstream 403599 5528844 ~ 5543064 (-)
CI01000325_05430077_05434997 NA other downstream 501388 5430010 ~ 5435253 (-)
CI01000325_04815250_04816016 CHURC1 other downstream 1120363 4815234 ~ 4816188 (-)
G464576 NA other downstream 2487263 3444730 ~ 3449178 (-)
G467570 NA other upstream 1678823 7615486 ~ 7616830 (-)
G467578 NA other upstream 2009682 7946345 ~ 7955192 (-)
CI01000325_08571807_08594165 NA other upstream 2627967 8568722 ~ 8594736 (-)
G467741 NA other upstream 2742509 8679172 ~ 8697583 (-)
CI01000325_09286047_09286556 ERH.L, ERH, ERH.S other upstream 3348869 9285532 ~ 9286556 (-)

Expression


Co-expression Network