G480699


Basic Information

Item Value
gene id G480699
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000339
NCBI id null
chromosome length 8057057
location 330308 ~ 330724 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU551623
ATTAACACTTATTTAACTCAAAACCAGATTCCTGGTTTATTTCATGATGCAGCAAAAATTGACTATCATAATTAGACTGAAGGGTGTTGTATTTGTGCTTTTCTTATTAATATCTCATGACTGCCACTTTTCTTACTATGTTGCTTACCAGAAGTTTCTGTCTTACCCATGATACTCTCCAAAAAGGTCCTGATGCCTATCCACAGCAGTGTATAAAAACTGATTTCTTGTTTTTTAAATATGAAATTCCAACTTTATTTTGAAAATAAAACAAAAGATAATAACCATAACTTGATTAGATATTAATAATAAAAAATTTAATTCCAGTATTAGTTACCTGTGAACCTTAATGTAGGGTGGACACTTGTGAACCATTTATTCATGAGTTATAAACATTAATAACCTGTGAAAGTGAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU551623 True 417 lncRNA 0.30 1 330308 330724

Neighbor

gene id symbol gene type direction distance location
CI01000339_00225794_00226825 NA coding upstream 103347 224628 ~ 226961 (+)
CI01000339_00214390_00215412 NA coding upstream 114424 214006 ~ 215884 (+)
CI01000339_00210534_00211598 NA coding upstream 118707 210059 ~ 211601 (+)
CI01000339_00188554_00189543 NA coding upstream 140130 188397 ~ 190178 (+)
CI01000339_00117608_00135474 SART3 coding upstream 194636 117608 ~ 135672 (+)
CI01000339_00336428_00365467 LIMK2 coding downstream 5159 335883 ~ 366764 (+)
CI01000339_00405927_00407508 NA coding downstream 75158 405882 ~ 408230 (+)
CI01000339_00531202_00532113 HS3ST1L2 coding downstream 199714 530438 ~ 532470 (+)
CI01000339_00541568_00553834 CDS2 coding downstream 210844 541568 ~ 553932 (+)
CI01000339_00563492_00576878 ARHGAP25 coding downstream 232768 563492 ~ 578031 (+)
G480662 NA non-coding upstream 153407 176547 ~ 176901 (+)
G480658 NA non-coding upstream 168276 161805 ~ 162032 (+)
G480657 NA non-coding upstream 169347 159992 ~ 160961 (+)
CI01000339_00069245_00092819 CORO1C, CORO1CA non-coding upstream 180472 69245 ~ 93266 (+)
G480644 NA non-coding upstream 292713 36370 ~ 37595 (+)
G480700 NA non-coding downstream 3593 334317 ~ 334711 (+)
G480708 NA non-coding downstream 44685 375409 ~ 383570 (+)
G480711 NA non-coding downstream 54785 385509 ~ 386481 (+)
G480721 NA non-coding downstream 72074 402798 ~ 403543 (+)
G480690 NA non-coding downstream 78465 409189 ~ 409969 (+)
G480663 NA other upstream 152325 177668 ~ 177983 (+)
G480761 NA other downstream 303690 634414 ~ 643423 (+)
G481321 NA other downstream 958597 1289321 ~ 1290733 (+)
CI01000339_01571624_01576903 NA other downstream 1243810 1571624 ~ 1577706 (+)
CI01000339_02196706_02198050 GABARAPL1, GABARAP.L, GABARAP, GABARAPA, GABARAPB, BRAFLDRAFT_122660, GBRAP other downstream 1865876 2196307 ~ 2198809 (+)
CI01000339_02821530_02821886 MRPL41 other downstream 2490036 2820576 ~ 2823479 (+)

Expression


Co-expression Network