G480688


Basic Information

Item Value
gene id G480688
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000339
NCBI id null
chromosome length 8057057
location 413964 ~ 414400 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU551612
TGAGGACGGCGATTCAGTGTAACATTATTCACACTGGAAAGGTGCGACGGAAAGCGTGGTGTTTCACAGACGACTCTCTGAGGCCTTATTATCCGTACTAATCAAAGACTGTCCAACTCCACACAGCACATGTGCACAACAAGGGGAGTCTCTGCACGGGTGTAAAGATACAGGGAGGGTGTCTGGGAGGGAGGGAAGGGGTAAAGCACTGCAGACTCACAGCCACCCAGCACTGGGCTCGCTTTCCTTCCTCCCTCTCTCCAACTTCCCCCCTCCCTCACTCTCTCTTTCACTCTTGCACTCTCCATTTCTGGCTGGACACTCGTTAGATGCGGCTACAATGAG

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU551612 True 345 lncRNA 0.53 2 413964 414400

Neighbor

gene id symbol gene type direction distance location
CI01000339_00405927_00407508 NA coding upstream 5734 405882 ~ 408230 (+)
CI01000339_00336428_00365467 LIMK2 coding upstream 47200 335883 ~ 366764 (+)
CI01000339_00225794_00226825 NA coding upstream 187003 224628 ~ 226961 (+)
CI01000339_00214390_00215412 NA coding upstream 198080 214006 ~ 215884 (+)
CI01000339_00210534_00211598 NA coding upstream 202363 210059 ~ 211601 (+)
CI01000339_00531202_00532113 HS3ST1L2 coding downstream 116038 530438 ~ 532470 (+)
CI01000339_00541568_00553834 CDS2 coding downstream 127168 541568 ~ 553932 (+)
CI01000339_00563492_00576878 ARHGAP25 coding downstream 149092 563492 ~ 578031 (+)
CI01000339_00585149_00589325 BMP10 coding downstream 170559 584959 ~ 590077 (+)
CI01000339_00608255_00608718 NA coding downstream 193855 608255 ~ 609464 (+)
G480690 NA non-coding upstream 3995 409189 ~ 409969 (+)
G480721 NA non-coding upstream 10421 402798 ~ 403543 (+)
G480711 NA non-coding upstream 27483 385509 ~ 386481 (+)
G480708 NA non-coding upstream 30394 375409 ~ 383570 (+)
G480700 NA non-coding upstream 79253 334317 ~ 334711 (+)
G480734 NA non-coding downstream 35140 449540 ~ 450224 (+)
G480750 NA non-coding downstream 77425 491825 ~ 492675 (+)
G480753 NA non-coding downstream 91972 506372 ~ 506620 (+)
G480755 NA non-coding downstream 95095 509495 ~ 509712 (+)
G480756 NA non-coding downstream 95914 510314 ~ 510532 (+)
G480663 NA other upstream 235981 177668 ~ 177983 (+)
CI01000339_00069245_00092819 CORO1C, CORO1CA other upstream 336372 69245 ~ 93266 (+)
G480761 NA other downstream 220014 634414 ~ 643423 (+)
G481321 NA other downstream 874921 1289321 ~ 1290733 (+)
CI01000339_01571624_01576903 NA other downstream 1160134 1571624 ~ 1577706 (+)
CI01000339_02196706_02198050 GABARAPL1, GABARAP.L, GABARAP, GABARAPA, GABARAPB, BRAFLDRAFT_122660, GBRAP other downstream 1782200 2196307 ~ 2198809 (+)
CI01000339_02821530_02821886 MRPL41 other downstream 2406360 2820576 ~ 2823479 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location