G678653


Basic Information

Item Value
gene id G678653
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 798689 ~ 798938 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU799312
TCACAAGATGTAATATAAGTCTCTGGTGTCTCCAGAATGTGTCTGTGAAGTTTCAGCTCAAAATCCCCCACAGATCATTTATTATAGCTTGTCAAATTTGCCCCTATTTGGGTGTGAGCAAAAACACGCCGTTTTTGTGTGTGTCCCTTTAAATGCAAATGAGCTGCTGCTCCCGGCCCCCTTTCCAGAAGAGGGCGGAGCTTTAACAGCTCGCGCTTCGGTCGCTCAACAACAACAAAGCTGGAGAATC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU799312 True 250 lncRNA 0.46 1 798689 798938

Neighbor

gene id symbol gene type direction distance location
CI01180000_00765917_00776252 NA coding upstream 21778 765797 ~ 776911 (+)
CI01180000_00737754_00743866 NA coding upstream 54478 735310 ~ 744211 (+)
CI01180000_00661446_00671602 MSH6 coding upstream 126501 661109 ~ 672188 (+)
CI01180000_00427700_00437883 NA coding upstream 360223 427650 ~ 438466 (+)
CI01180000_00368639_00375465 ZC3H6 coding upstream 422442 368639 ~ 376247 (+)
CI01180000_00812535_00858607 NA coding downstream 12919 811857 ~ 859005 (+)
CI01180000_00862066_00867985 NA coding downstream 61808 860746 ~ 868112 (+)
CI01180000_00947514_00949868 NA coding downstream 147483 946421 ~ 950906 (+)
CI01180000_00955725_01050852 SIPA1L2 coding downstream 155984 954922 ~ 1051826 (+)
CI01180000_01196818_01224406 EGLN1B, EGLN1, EGLN1A coding downstream 397848 1196786 ~ 1224915 (+)
G678720 NA non-coding upstream 12027 786361 ~ 786662 (+)
G678717 NA non-coding upstream 14487 783915 ~ 784202 (+)
G678629 NA non-coding upstream 18099 779794 ~ 780590 (+)
G678633 NA non-coding upstream 19070 777607 ~ 779619 (+)
G678640 NA non-coding upstream 21685 747265 ~ 777004 (+)
G678660 NA non-coding downstream 4013 802951 ~ 803490 (+)
G678736 NA non-coding downstream 78414 877352 ~ 877598 (+)
G678638 NA non-coding downstream 81078 880016 ~ 883028 (+)
G678639 NA non-coding downstream 103672 902610 ~ 907382 (+)
G678649 NA non-coding downstream 241447 1040385 ~ 1090851 (+)
G678440 NA other upstream 647037 147934 ~ 151652 (+)
G678751 NA other downstream 260905 1059843 ~ 1066091 (+)
G678637 NA other downstream 350613 1149551 ~ 1155672 (+)
G678946 NA other downstream 719415 1518353 ~ 1612547 (+)
G679076 NA other downstream 996232 1795170 ~ 1799433 (+)
G679324 NA other downstream 1589929 2388867 ~ 2397360 (+)

Expression


Co-expression Network