G680303


Basic Information

Item Value
gene id G680303
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 2889855 ~ 2890291 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU801142
AACTAACAATTTTACAAACAAAGGCTGAGATTACACTCAGTTTTCACATCACATTCTACACAACATACCAAACAATAAAGACAAAAGAAAAGACAGAAAGAGAGGGAAAAAAAGTAGGGGAGTAGGAGGTTTTTATATTATAGAACCAAAATCCTCTAATATAGAATACAAATACTTTGCTTTGGGACCTTTCATCCCTAATGTCTCCAAAAATATATATAAACCTCTTTAAAAACCATTAATCTTGGCGGAATATTGAAAAATGTACATTCATGTATGTAAAATTTCAGCAAAAGCAACAAAACTGGTGTTTAAGCCTTCATATTGCAGATTTAACACCATAAATCAATCCTGTGATGAAACAATTCTCTCAAAACACACCAGTTATCAGCTGTACAATCATATACTGTGATTTCTTGACTTGTGTTGAACGTTAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU801142 True 437 lncRNA 0.32 1 2889855 2890291

Neighbor

gene id symbol gene type direction distance location
CI01180000_02690045_02691641 NKX6-2, NKX6-2.L, NKX6.2 coding upstream 197672 2689271 ~ 2693221 (+)
CI01180000_02613130_02639905 NA coding upstream 249933 2612278 ~ 2639922 (+)
CI01180000_02574027_02588521 NA coding upstream 301031 2574027 ~ 2588824 (+)
CI01180000_02541296_02567509 CFAP46 coding upstream 322072 2541296 ~ 2567783 (+)
CI01180000_02362001_02362428 NA coding upstream 526325 2361960 ~ 2363530 (+)
CI01180000_02951792_02968343 STK32C coding downstream 61501 2951792 ~ 2968343 (+)
CI01180000_02998131_03010201 NA coding downstream 107840 2998131 ~ 3010503 (+)
CI01180000_03077007_03078238 NA coding downstream 186316 3076607 ~ 3078799 (+)
CI01180000_03149731_03154047 NA coding downstream 258756 3149047 ~ 3154088 (+)
CI01180000_03210894_03214195 LBH coding downstream 320603 3210894 ~ 3214720 (+)
G680219 NA non-coding upstream 225 2877311 ~ 2889630 (+)
G680296 NA non-coding upstream 31544 2857324 ~ 2858311 (+)
G680294 NA non-coding upstream 35833 2853807 ~ 2854022 (+)
G680263 NA non-coding upstream 83393 2805661 ~ 2806462 (+)
G680242 NA non-coding upstream 118826 2770788 ~ 2771029 (+)
G680304 NA non-coding downstream 2868 2893159 ~ 2893439 (+)
G680306 NA non-coding downstream 5235 2895526 ~ 2895933 (+)
G680308 NA non-coding downstream 12157 2902448 ~ 2902669 (+)
G680309 NA non-coding downstream 13550 2903841 ~ 2904164 (+)
G680349 NA non-coding downstream 76667 2966958 ~ 2967757 (+)
G679324 NA other upstream 492495 2388867 ~ 2397360 (+)
G679076 NA other upstream 1090422 1795170 ~ 1799433 (+)
G678946 NA other upstream 1333704 1518353 ~ 1612547 (+)
G678637 NA other upstream 1734183 1149551 ~ 1155672 (+)
CI01180000_03571292_03571611 GNG2.L, GBG2, GNG2 other downstream 662986 3569165 ~ 3573135 (+)
G680736 NA other downstream 875400 3765691 ~ 3784441 (+)
G681137 NA other downstream 1893014 4783305 ~ 4785631 (+)
G681268 NA other downstream 2480119 5370410 ~ 5373762 (+)
G681592 NA other downstream 3582744 6471995 ~ 6478999 (+)

Expression


Co-expression Network