G680884


Basic Information

Item Value
gene id G680884
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01180000
NCBI id null
chromosome length 11503085
location 4066194 ~ 4066401 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU801803
GGAAAATTGGCTTCTTTGCACTTTTATATAAATATTTATTAAATATTTTGCATGCATGTTGTAAAGTTGTGCCTCGAGTGTAAAACTAATGTATGCATTCCATGTTTCAGTTGTATCATTTGTCATGATGCAATGGAACATATCAAATTGTGTGGATGTCATTTTTGGCCAAGTGGTAATACTAAGCTTGCACTCATTATCCCCAGCC

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU801803 True 208 lncRNA 0.34 1 4066194 4066401

Neighbor

gene id symbol gene type direction distance location
CI01180000_04010876_04029709 LETM1 coding upstream 36088 4010876 ~ 4030106 (+)
CI01180000_03906328_03978950 KIAA1109 coding upstream 86346 3906328 ~ 3979848 (+)
CI01180000_03886676_03894240 C22H9ORF72, CLG15H9ORF72, CSGR16H9ORF72, C3H9ORF72, CUNH9ORF72, C1H9ORF72, CLG4H9ORF72 coding upstream 171580 3885861 ~ 3894614 (+)
CI01180000_03874309_03876138 LINGO2B, LINGO2 coding upstream 189370 3874211 ~ 3876824 (+)
CI01180000_03835051_03839911 EIF4E, EIF4EA, EIF4EB coding upstream 225455 3834488 ~ 3840739 (+)
CI01180000_04249587_04251719 FOXI2 coding downstream 183051 4249452 ~ 4252451 (+)
CI01180000_04292374_04295052 CFD coding downstream 225340 4291741 ~ 4295131 (+)
CI01180000_04302604_04322081 NA coding downstream 235427 4301828 ~ 4324310 (+)
CI01180000_04375200_04414909 SLC4A11 coding downstream 308799 4375200 ~ 4415038 (+)
CI01180000_04417522_04418042 NA coding downstream 351121 4417522 ~ 4419271 (+)
G680882 NA non-coding upstream 1366 4064461 ~ 4064828 (+)
G680879 NA non-coding upstream 3722 4062165 ~ 4062472 (+)
G680869 NA non-coding upstream 84943 3981011 ~ 3981251 (+)
G680864 NA non-coding upstream 183588 3882268 ~ 3882606 (+)
G680856 NA non-coding upstream 197740 3868061 ~ 3868454 (+)
G680886 NA non-coding downstream 1562 4067963 ~ 4068320 (+)
G680889 NA non-coding downstream 6292 4072693 ~ 4072945 (+)
G680893 NA non-coding downstream 8686 4075087 ~ 4075296 (+)
G680929 NA non-coding downstream 77208 4143609 ~ 4143837 (+)
G680931 NA non-coding downstream 79737 4146138 ~ 4146417 (+)
G680736 NA other upstream 281753 3765691 ~ 3784441 (+)
CI01180000_03571292_03571611 GNG2.L, GBG2, GNG2 other upstream 493797 3569165 ~ 3573135 (+)
CI01180000_02690045_02691641 NKX6-2, NKX6-2.L, NKX6.2 other upstream 1370758 2689271 ~ 2693221 (+)
G679324 NA other upstream 1668834 2388867 ~ 2397360 (+)
G679076 NA other upstream 2266761 1795170 ~ 1799433 (+)
G681137 NA other downstream 716904 4783305 ~ 4785631 (+)
G681268 NA other downstream 1304009 5370410 ~ 5373762 (+)
G681592 NA other downstream 2406634 6471995 ~ 6478999 (+)
G681686 NA other downstream 2566507 6632908 ~ 6634989 (+)
G681667 NA other downstream 2589445 6655846 ~ 6659546 (+)

Expression


Co-expression Network