XLOC_016853


Basic Information

Item Value
gene id XLOC_016853
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 48634551 ~ 48635580 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00033950
GATGCATCGGGTGTCCTGGCCAGCTGCATTGAGACGCAAAATATATCTTCATTTCTCCGTTTATGCTCTCAACATTATCACAAAGCCAAGCTGCATATGACCCAGACTGAGCACCATCTCTACATCTGGGCCACAAAGAAACTACACAGACAGACACTGCACACTCTGCAAGAAAAATTTAGAGGAGGGAAAGAAAACCAACACTGCAGTCAGCTGAAGATGTGGACGACCAACATGCTGAGAAGGAGACACTTGAGGTTGAAGATGGTGAGAGATACTGATGAGAAGACACACAACACTAAGGAGGTAGCTTAGGCAAACTGAATGTAAATTGTGTATGGACATGTGTAGATGTAAACCGCCTGTTGGAGAACTGACAGCTGCTGTGTGAACTTGAAGGATACAGGATGTCTGATGGATTTTGT
>TCONS_00033951
AACGGATGCATCGGGTGTCCTGGCCAGCTGCATTGAGACGCAAAATATATCTTCATTTCTCCGTTTATGCTCTCAACATTATCACAAAGGTAAGTACGAAAGATTATTTAAGTAACTTTACAACTGTCATTGCTTGAgcttcaaattattttattaattcaatgtaacactttagttttgggggtaaaactgcatttaaatatttacgaAGCAACTTAGTGCTTATGGATTTAAGATTGTAAAGTAATTGATtggaaaaatattgtaaaataattttttacaacttAGATTTGCTGATGTACTTACTCCCTGACAAAAAGTactttttcttaaaacaaatatagctttttGTTGAAATCATTcccttaaatgtttaaaatttccAGACTGTAACTTcatgaaactgcagttaaaaaacCCAGTTCTTTTCCActgtagaaaaaatataaatatattggatGACAAAGTTAATGCTTAAAAGTTCAAAATTCAATTCAGGTTTCTTATGCTAAAACAAGTCATAATTTATAAGCATGTAGCATTATAgtacatttatttgttatattttacaaataaattatatatttctacttttaatatatattttatttttaaatttatattttttttatatattattttattgttatatttttgctgtatttacatttctaacTTTGTCACTGCCAGCCAAGCTGCATATGACCCAGACTGAGCACCATCTCTACATCTGGGCCACAAAGAAACTACACAGACAGACACTGCACACTCTGCAAGAAAAATTTAGAGGAGGGAAAGAAAACCAACACTGCAGTCAGCTGAAGATGTGGACGACCAACATGCTGAGAAGGAGACACTTGAGGTTGAAGATGGTGAGAGATACTGATGAGAAGACACACAACACTAAGGAGGTAGCTTAGGCAAACTGAATGTAAATTGTGTATGGACATGTGTAGATGTAAACCGCCTGTTGGAGAACTGACAGCTGCTGTGTGAACTTGAAGGATACAGGATGTCTGATGGATTTTGT

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00033950 False 425 lncRNA 0.45 2 48634551 48635576
TCONS_00033951 True 1030 lncRNA 0.32 1 48634551 48635580

Neighbor

gene id symbol gene type direction distance location
XLOC_016852 CR381673.3 coding downstream 69605 48564830 ~ 48564946 (-)
XLOC_016851 si:dkeyp-94g1.1 coding downstream 73080 48545804 ~ 48561471 (-)
XLOC_016850 CR391991.4 coding downstream 94878 48519594 ~ 48539673 (-)
XLOC_016848 CR391991.1 coding downstream 122101 48478399 ~ 48512450 (-)
XLOC_016849 CR391991.5 coding downstream 137376 48496207 ~ 48497175 (-)
XLOC_016854 NA coding upstream 75568 48711148 ~ 48714636 (-)
XLOC_016855 NA coding upstream 95899 48731479 ~ 48732528 (-)
XLOC_016856 NA coding upstream 103962 48739542 ~ 48743994 (-)
XLOC_016857 CABZ01044731.1 coding upstream 111103 48746683 ~ 48746812 (-)
XLOC_016858 CABZ01044731.2 coding upstream 112674 48748254 ~ 48753873 (-)
XLOC_016845 NA non-coding downstream 211418 48418390 ~ 48423133 (-)
XLOC_016843 NA non-coding downstream 228346 48405044 ~ 48406205 (-)
XLOC_016842 NA non-coding downstream 238490 48394943 ~ 48396061 (-)
XLOC_016839 NA non-coding downstream 359008 48267344 ~ 48275543 (-)
XLOC_016862 NA non-coding upstream 706007 49341587 ~ 49348204 (-)

Expression


Co-expression Network