RNA id: TCONS_00033950


Basic Information

Item Value
RNA id TCONS_00033950
length 425
lncRNA type inter_gene
GC content 0.45
exon number 2
gene id XLOC_016853
representative False

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 48634551 ~ 48635580 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GATGCATCGGGTGTCCTGGCCAGCTGCATTGAGACGCAAAATATATCTTCATTTCTCCGTTTATGCTCTCAACATTATCACAAAGCCAAGCTGCATATGACCCAGACTGAGCACCATCTCTACATCTGGGCCACAAAGAAACTACACAGACAGACACTGCACACTCTGCAAGAAAAATTTAGAGGAGGGAAAGAAAACCAACACTGCAGTCAGCTGAAGATGTGGACGACCAACATGCTGAGAAGGAGACACTTGAGGTTGAAGATGGTGAGAGATACTGATGAGAAGACACACAACACTAAGGAGGTAGCTTAGGCAAACTGAATGTAAATTGTGTATGGACATGTGTAGATGTAAACCGCCTGTTGGAGAACTGACAGCTGCTGTGTGAACTTGAAGGATACAGGATGTCTGATGGATTTTGT

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033410 lncRNA downstream 211418 48418390 ~ 48423133 (-) True XLOC_016845
TCONS_00033949 lncRNA downstream 228348 48405044 ~ 48406203 (-) False XLOC_016843
TCONS_00033948 lncRNA downstream 239027 48394943 ~ 48395524 (-) False XLOC_016842
TCONS_00033409 lncRNA downstream 359008 48267344 ~ 48275543 (-) False XLOC_016839
TCONS_00033408 lncRNA downstream 359008 48267344 ~ 48275543 (-) True XLOC_016839
TCONS_00033411 lncRNA upstream 75572 48711148 ~ 48714636 (-) True XLOC_016854
TCONS_00033412 lncRNA upstream 95903 48731479 ~ 48732144 (-) False XLOC_016855
TCONS_00033413 lncRNA upstream 95903 48731479 ~ 48732528 (-) True XLOC_016855
TCONS_00033952 lncRNA upstream 103966 48739542 ~ 48743994 (-) True XLOC_016856
TCONS_00033953 lncRNA upstream 706011 49341587 ~ 49348204 (-) True XLOC_016862
TCONS_00032990 mRNA downstream 73080 48545804 ~ 48561471 (-) True XLOC_016851
TCONS_00032989 mRNA downstream 94878 48519594 ~ 48539673 (-) True XLOC_016850
TCONS_00032987 mRNA downstream 122101 48478399 ~ 48512450 (-) True XLOC_016848
TCONS_00032988 mRNA downstream 137376 48496207 ~ 48497175 (-) True XLOC_016849
TCONS_00032986 mRNA downstream 170872 48458703 ~ 48463679 (-) True XLOC_016847
TCONS_00032993 mRNA upstream 112678 48748254 ~ 48753873 (-) True XLOC_016858
TCONS_00032994 mRNA upstream 182382 48817958 ~ 48826707 (-) True XLOC_016859
TCONS_00032995 mRNA upstream 315211 48950787 ~ 48966431 (-) True XLOC_016860
TCONS_00032996 mRNA upstream 372016 49007592 ~ 49031303 (-) True XLOC_016861
TCONS_00032997 mRNA upstream 731108 49366684 ~ 49370042 (-) True XLOC_016863
TCONS_00032991 other downstream 69605 48564830 ~ 48564946 (-) True XLOC_016852
TCONS_00032983 other downstream 228346 48405272 ~ 48406205 (-) True XLOC_016843
TCONS_00032976 other downstream 477314 48145089 ~ 48157237 (-) True XLOC_016835
TCONS_00032964 other downstream 781467 47852969 ~ 47853084 (-) True XLOC_016829
TCONS_00032961 other downstream 1088912 47541737 ~ 47545639 (-) True XLOC_016826
TCONS_00032992 other upstream 111107 48746683 ~ 48746812 (-) True XLOC_016857
TCONS_00033002 other upstream 1031180 49666756 ~ 49667049 (-) True XLOC_016868
TCONS_00033003 other upstream 1132002 49767578 ~ 49769552 (-) True XLOC_016869
TCONS_00033024 other upstream 1837850 50473426 ~ 50473542 (-) True XLOC_016880
TCONS_00033026 other upstream 2073790 50709366 ~ 50709482 (-) True XLOC_016882

Expression Profile

//