G187094 (bpnt1,LOC102799416)


Basic Information

Item Value
gene id G187094
gene name bpnt1,LOC102799416
gene type unknown
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053129.1
NCBI id CM020926.1
chromosome length 36987114
location 24506913 ~ 24507813 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU253479
CCAACAGCATGCAGAATGGCTTCAGGAGCACAGGTGTCCCACTTCTTGCACCCTGGACTGGCGAAGACATAAGCAGAAGCCTTTCCTTCAACAAGCTGAATCTTGTTCCCAGCACCCCCCACTTTTATAACTTCATGAGGCTCCATGGCGTTTACACAGTCCGTTACCAGCTTGTTGCTATGGGAACGTGTGGTGGTGACGATGCGTCTGTCACCTGGAACTTCCTGCAGCTGAAATCCAAAAGCGCCCAATCCCAGCATTCCCCACATGGTTCTTCCTAAAGATGCTCCTGCTCCAAGCTGACGAGGAAAATGTTT

Function

symbol description
bpnt1 Predicted to enable 3'(2'),5'-bisphosphate nucleotidase activity. Predicted to act upstream of or within inositol phosphate dephosphorylation and phosphatidylinositol phosphate biosynthetic process. Is expressed in intestinal bulb. Orthologous to human BPNT1 (3'(2'), 5'-bisphosphate nucleotidase 1).

NR:

description
PREDICTED: 3'(2'),5'-bisphosphate nucleotidase 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU253479 True 317 TUCP 0.51 2 24506913 24507813

Neighbor

gene id symbol gene type direction distance location
LOC120546832 ppp1cb,LOC100692170,LOC103030509 coding upstream 524 24498746 ~ 24506389 (+)
LOC120546425 NA coding upstream 21314 24446908 ~ 24485599 (+)
rars2 rars2 coding upstream 70590 24419260 ~ 24436323 (+)
akirin2 LOC104936192,LOC106911218,LOC103359156,LOC103457369,LOC102236332,LOC103133163 coding upstream 89113 24413847 ~ 24417800 (+)
cnr1 cnr1,LOC104936193 coding upstream 94583 24408071 ~ 24412330 (+)
grcc10 clg15h12orf57,c7h12orf57,LOC102299093,LOC107105086,LOC105938778,LOC101473413,LOC102199733 coding downstream 7631 24515444 ~ 24518183 (+)
LOC120546974 LOC102776492,LOC103132202,LOC103457360,LOC107105132,LOC102297120,LOC103359253,LOC106962735,LOC108233450 coding downstream 22518 24530331 ~ 24630590 (+)
fntb LOC103359368,LOC108233508 coding downstream 730014 25237827 ~ 25261246 (+)
slc10a1 NA coding downstream 774121 25281934 ~ 25294676 (+)
LOC120547103 LOC104958218,LOC103359443,LOC102785120,LOC102304693 coding downstream 833780 25341593 ~ 25350144 (+)
G187074 NA non-coding upstream 119745 24386956 ~ 24387168 (+)
G187027 NA non-coding upstream 272162 24211413 ~ 24234751 (+)
G186972 NA non-coding upstream 359695 24072763 ~ 24147218 (+)
G186961 NA non-coding upstream 581265 23868280 ~ 23925648 (+)
G186954 NA non-coding upstream 644979 23829525 ~ 23861934 (+)
G187158 NA non-coding downstream 128912 24636725 ~ 24639484 (+)
G187165 ptprk,LOC102777941 non-coding downstream 148157 24655970 ~ 24656643 (+)
LOC120546772 NA non-coding downstream 501700 25009513 ~ 25012350 (+)
G187212 NA non-coding downstream 603233 25111046 ~ 25143492 (+)
G187235 NA non-coding downstream 709340 25217153 ~ 25218783 (+)
extl3 extl3 other upstream 319049 24155487 ~ 24187864 (+)
LOC120547070 NA other upstream 360151 24144997 ~ 24146762 (+)
G186975 NA other upstream 423809 24079603 ~ 24083104 (+)
nfkbie nfkbie other upstream 917224 23578378 ~ 23589689 (+)
tcte1 NA other upstream 942484 23559498 ~ 23564429 (+)
lama2 lama2,LOC104942190 other downstream 302266 24810079 ~ 25009457 (+)
trnat-ugu_3 NA other downstream 712055 25219868 ~ 25219940 (+)
abracl abracl,LOC103376263 other downstream 1421763 25929576 ~ 25935271 (+)
LOC120546493 NA other downstream 1447437 25955250 ~ 25968925 (+)
nudt14 nudt14,LOC107560374 other downstream 1499041 26006854 ~ 26036232 (+)

Expression


Co-expression Network