G187165 (ptprk,LOC102777941)


Basic Information

Item Value
gene id G187165
gene name ptprk,LOC102777941
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053129.1
NCBI id CM020926.1
chromosome length 36987114
location 24655970 ~ 24656643 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU253556
ATGCTATAATGTTCCCATAGCGGTTCTTGGTACGGTTCTGATCCTTCTTGGCCACGTCCCAGGAGGCCGACTGGCCCTCGAAGAAGCTCTGTATCACTTCATACTCCTCCTTAAAGCCGTAGCTGTCAGATGTTTTCATCAGGTTGATGTGCTGCAGAAGATCGGCCACTCTGATGGCAGGGTGAAGCTGTCCAGTCTGATAGGGAGATTCGGTTCCTTCACAGTGATACCGAGGAACATCCAGAAGCCTGCTGTTCTCCGCTGCAGAGCCACTGTGGTTCTCATCTACAACAAAAGAGGAAATTACTGGTTAGTTCA

Function

symbol description
ptprk Predicted to enable protein tyrosine phosphatase activity. Predicted to be involved in protein dephosphorylation. Predicted to act upstream of or within dephosphorylation. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in several structures, including cardiovascular system; digestive system; immature eye; musculature system; and nervous system. Orthologous to human PTPRK (protein tyrosine phosphatase receptor type K).

NR:

description
PREDICTED: receptor-type tyrosine-protein phosphatase kappa isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU253556 True 318 lncRNA 0.50 2 24655970 24656643

Neighbor

gene id symbol gene type direction distance location
LOC120546974 LOC102776492,LOC103132202,LOC103457360,LOC107105132,LOC102297120,LOC103359253,LOC106962735,LOC108233450 coding upstream 25380 24530331 ~ 24630590 (+)
grcc10 clg15h12orf57,c7h12orf57,LOC102299093,LOC107105086,LOC105938778,LOC101473413,LOC102199733 coding upstream 137787 24515444 ~ 24518183 (+)
LOC120546832 ppp1cb,LOC100692170,LOC103030509 coding upstream 149581 24498746 ~ 24506389 (+)
LOC120546425 NA coding upstream 170371 24446908 ~ 24485599 (+)
rars2 rars2 coding upstream 219647 24419260 ~ 24436323 (+)
fntb LOC103359368,LOC108233508 coding downstream 581184 25237827 ~ 25261246 (+)
slc10a1 NA coding downstream 625291 25281934 ~ 25294676 (+)
LOC120547103 LOC104958218,LOC103359443,LOC102785120,LOC102304693 coding downstream 684950 25341593 ~ 25350144 (+)
gpr176 gpr176 coding downstream 694586 25351229 ~ 25368337 (+)
katnbl1 katnbl1 coding downstream 932585 25589228 ~ 25596709 (+)
G187158 NA non-coding upstream 16486 24636725 ~ 24639484 (+)
G187074 NA non-coding upstream 268802 24386956 ~ 24387168 (+)
G187027 NA non-coding upstream 421219 24211413 ~ 24234751 (+)
G186972 NA non-coding upstream 508752 24072763 ~ 24147218 (+)
G186961 NA non-coding upstream 730322 23868280 ~ 23925648 (+)
LOC120546772 NA non-coding downstream 352870 25009513 ~ 25012350 (+)
G187212 NA non-coding downstream 454403 25111046 ~ 25143492 (+)
G187235 NA non-coding downstream 560510 25217153 ~ 25218783 (+)
G187236 NA non-coding downstream 570937 25227580 ~ 25227839 (+)
G187238 NA non-coding downstream 579888 25236531 ~ 25236879 (+)
G187094 bpnt1,LOC102799416 other upstream 148157 24506913 ~ 24507813 (+)
extl3 extl3 other upstream 468106 24155487 ~ 24187864 (+)
LOC120547070 NA other upstream 509208 24144997 ~ 24146762 (+)
G186975 NA other upstream 572866 24079603 ~ 24083104 (+)
nfkbie nfkbie other upstream 1066281 23578378 ~ 23589689 (+)
lama2 lama2,LOC104942190 other downstream 153436 24810079 ~ 25009457 (+)
trnat-ugu_3 NA other downstream 563225 25219868 ~ 25219940 (+)
abracl abracl,LOC103376263 other downstream 1272933 25929576 ~ 25935271 (+)
LOC120546493 NA other downstream 1298607 25955250 ~ 25968925 (+)
nudt14 nudt14,LOC107560374 other downstream 1350211 26006854 ~ 26036232 (+)

Expression


Co-expression Network