G37525 (evc2)


Basic Information

Item Value
gene id G37525
gene name evc2
gene type unknown
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053115.1
NCBI id CM020912.1
chromosome length 44863486
location 11352078 ~ 11352387 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU50347
TGAAGAAAGCTCTGCATTGCGCCCTGAGCTCTCTCTGCTCCTGCAGCTCTCTCTCAATGGCATCCCGCAGAGCCTCCCTGGTGCAGCTGAGGGTGCGTAAGGCTGCCTTGCCTTCCTGGTGCAACCTTTCCTGGCCCTGCAAGAGAGCGCTCACTCCTTGTCCCTGGGCATGTCCTGGTCCTGCCTCAGGTTCCACCTGCAGCACGGAGCGTTGTGCCCCTGGAGGCAGAAGGGTTAGCAAGGCCTGGGTTGCAGAAGGCTGGATGGCTTTGACTTCTATTAAGGCACCCTGGATCATACGCATGGTCAC

Function

symbol description
evc2 Predicted to be involved in smoothened signaling pathway. Located in nucleus. Implicated in Ellis-Van Creveld syndrome and Weyers acrofacial dysostosis.

NR:

description
PREDICTED: limbin

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU50347 True 310 TUCP 0.59 1 11352078 11352387

Neighbor

gene id symbol gene type direction distance location
msx1a msx1 coding upstream 19432 11330556 ~ 11332646 (+)
LOC120558115 NA coding upstream 86008 11263510 ~ 11266070 (+)
LOC120558172 LOC104927939,LOC104961953,LOC100699369,LOC102798792,LOC103359250 coding upstream 108713 11236707 ~ 11243365 (+)
aggf1 aggf1 coding upstream 125496 11219389 ~ 11226582 (+)
r3hcc1 LOC104945372 coding upstream 184272 11156708 ~ 11167806 (+)
LOC120557333 evc coding downstream 9019 11361406 ~ 11375812 (+)
LOC120557335 LOC103359258,LOC101476783 coding downstream 24148 11376535 ~ 11382180 (+)
myl9b LOC100697131,LOC101062217,LOC105901900,LOC103386121,LOC106565219 coding downstream 541203 11893590 ~ 11905754 (+)
LOC120557971 kiaa1755 coding downstream 728718 12081105 ~ 12111841 (+)
tgm2b tgm2,LOC103354993 coding downstream 761621 12114008 ~ 12127710 (+)
G37524 evc2 non-coding upstream 2305 11349550 ~ 11349773 (+)
G37523 NA non-coding upstream 2710 11349136 ~ 11349368 (+)
G37522 NA non-coding upstream 4407 11347086 ~ 11347671 (+)
G37521 NA non-coding upstream 7019 11344740 ~ 11345059 (+)
G37383 fam219a non-coding upstream 408452 10936683 ~ 10943626 (+)
G37526 NA non-coding downstream 1889 11354276 ~ 11354743 (+)
G37527 evc2 non-coding downstream 3242 11355629 ~ 11356360 (+)
G37528 NA non-coding downstream 7386 11359773 ~ 11360248 (+)
G37553 NA non-coding downstream 55589 11407976 ~ 11416351 (+)
G37560 NA non-coding downstream 69136 11421523 ~ 11421722 (+)
G37397 LOC102299939,LOC103353648,LOC103366902,LOC102208776,LOC100700987,LOC104921056 other upstream 339169 10997230 ~ 11012909 (+)
glrx glrx other upstream 955891 10387908 ~ 10396187 (+)
G37197 NA other upstream 1042082 10305187 ~ 10309996 (+)
prickle2b prickle2 other upstream 1495422 9760233 ~ 9856656 (+)
G36744 NA other upstream 3123358 8227762 ~ 8228720 (+)
LOC120557336 LOC103359259,LOC100704408,LOC101476502,LOC102796717,LOC102216118 other downstream 32797 11385184 ~ 11394398 (+)
G37597 NA other downstream 427791 11780178 ~ 11805394 (+)
G37714 NA other downstream 900679 12253066 ~ 12254974 (+)
LOC120557851 krt18,LOC105931717,LOC101469154 other downstream 922373 12274760 ~ 12278624 (+)
G37730 NA other downstream 1033784 12386171 ~ 12387175 (+)

Expression


Co-expression Network