G9978



Basic Information


Item Value
gene id G9978
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030121.1
NCBI id CM030121.1
chromosome length 57050121
location 56959234 ~ 56959738 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU12406
AGGGGTCACAGCGCTGCATGTTGCTGTGTTGAACCAGAACGTGAACCTGGTCCGTGAGCTGATTGCCCGAGGGGCGGATGCGTCATCGCCGATGGCAACGGGCTGGTACTTCAGGAAGAAGAGAGGGGGGCAATTTTTCTTTGGGGAGCACGTGCTGTCGTTCGCTGCGGCTGTGGGCAACGCGGAGATCCTTTCCATGGTGATCGAGGCGGGAGCTGACATCAGAGCCCAGGACAGTCTGGGTAA

Function


GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU12406 True 246 lncRNA 0.47 2 56959234 56959738

Neighbor


gene id symbol gene type direction distance location
AMCG00004701 LOC103393816,LOC101468857,LOC106519603 coding upstream 33036 56915322 ~ 56926198 (+)
AMCG00004703 NA coding upstream 72436 56878405 ~ 56886798 (+)
AMCG00004696 NA coding upstream 115504 56841116 ~ 56843730 (+)
AMCG00004694 NA coding upstream 138445 56814414 ~ 56820789 (+)
AMCG00004687 NA coding upstream 180808 56775205 ~ 56778426 (+)
G9942 NA non-coding upstream 4626 56908176 ~ 56954608 (+)
G9941 NA non-coding upstream 59321 56846054 ~ 56899913 (+)
G9958 NA non-coding upstream 105383 56852941 ~ 56853851 (+)
G9957 NA non-coding upstream 107095 56849372 ~ 56852139 (+)
G9932 NA non-coding upstream 185516 56765053 ~ 56773718 (+)
G9988 NA non-coding downstream 56143 57015881 ~ 57019723 (+)
G9989 NA non-coding downstream 65774 57025512 ~ 57027870 (+)
AMCG00004702 NA other upstream 63019 56664140 ~ 56896215 (+)
AMCG00004700 NA other upstream 92103 56861354 ~ 56867131 (+)
AMCG00004695 gapdh,LOC107596669 other upstream 157342 56785852 ~ 56801892 (+)
G9889 NA other upstream 417171 56538254 ~ 56542063 (+)
AMCG00004681 NA other upstream 459650 56490093 ~ 56499584 (+)
AMCG00004707 NA other downstream 1775 56961513 ~ 57002024 (+)
G9982 NA other downstream 27168 56986906 ~ 56987644 (+)

Expression



Co-expression Network