AMCG00006010 (tpm4b,LOC107596277,LOC105022485)


Basic Information

Item Value
gene id AMCG00006010
gene name tpm4b,LOC107596277,LOC105022485
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030142.1
NCBI id CM030142.1
chromosome length 21087710
location 14300796 ~ 14305776 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00006010
ATGGAAGCCATCAAGAAGAAGATGCAGATGCTGAAGCTGGACAAGGAGAATGCCATCGACCGCGCGGAGCAGGCAGAGTCCGACAAGAAAGCTGCGGAGGACAAGTGCAAGCAGCTGGAAGATGAGCTGATTGGCTTGCAGAAGAAGCTGAAAAGTACTGAGGACGAGCTGGACAAATACTCTGAAGCATTGAAAGATGCCCAGGAGAAACTGGAACTGTCTGAGAAGAAGGCCACTGACGTGAGTACAGGAGCCTGGGAGTCAACTGAGCCATCATCCCTAGATACACCACACCCTGCCACCCCACCTCCCCAACTCTAG

Function

symbol description
tpm4b Predicted to enable actin filament binding activity. Predicted to be involved in actin filament organization and muscle contraction. Predicted to be active in actin filament. Is expressed in cardiovascular system; cephalic musculature; epiphysis; and otic vesicle. Orthologous to human TPM4 (tropomyosin 4).

NR:

description
PREDICTED: tropomyosin alpha-1 chain-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00006010 True 321 mRNA 0.53 2 14300796 14305776

Neighbor

gene id symbol gene type direction distance location
AMCG00005994 NA coding upstream 51005 14219279 ~ 14249791 (+)
AMCG00005995 NA coding upstream 89831 14198874 ~ 14210965 (+)
AMCG00005993 NA coding upstream 114214 14180861 ~ 14186582 (+)
AMCG00005962 NA coding upstream 218609 14080451 ~ 14082187 (+)
AMCG00005980 ap1m1,LOC103354064,LOC107696211 coding upstream 352332 13936793 ~ 13948464 (+)
AMCG00006011 tpm4,LOC106573547 coding downstream 3315 14309091 ~ 14325447 (+)
AMCG00006008 rab8a,LOC103479775,LOC107687930,LOC107696202 coding downstream 41382 14347158 ~ 14357815 (+)
AMCG00006007 NA coding downstream 56498 14362274 ~ 14369543 (+)
AMCG00006021 pole4,LOC107680508,LOC107747219,LOC107597157 coding downstream 145142 14450918 ~ 14452853 (+)
AMCG00006025 NA coding downstream 160355 14466131 ~ 14467258 (+)
G155634 NA non-coding upstream 115987 14172164 ~ 14184809 (+)
G155641 eps15l1 non-coding upstream 175912 14124608 ~ 14124884 (+)
G155640 NA non-coding upstream 177449 14122998 ~ 14123347 (+)
G155639 NA non-coding upstream 178023 14122127 ~ 14122773 (+)
G155636 NA non-coding upstream 204651 14095023 ~ 14096145 (+)
G155728 NA non-coding downstream 183504 14489280 ~ 14491876 (+)
G155744 NA non-coding downstream 187950 14493726 ~ 14494082 (+)
G155772 NA non-coding downstream 241594 14547370 ~ 14547600 (+)
G155773 LOC106568166,LOC108280735,LOC103375566 non-coding downstream 241883 14547659 ~ 14548153 (+)
G155774 NA non-coding downstream 242820 14548596 ~ 14549068 (+)
G155638 NA other upstream 190926 14108173 ~ 14109870 (+)
G155637 eps15l1,LOC107592720 other upstream 202100 14097804 ~ 14098696 (+)
AMCG00005964 gpx4b,gpx4,LOC107723219,LOC107660382 other upstream 1267388 13025764 ~ 13033408 (+)
AMCG00005935 LOC105903927,LOC107660390,LOC105900968,LOC108427173,LOC107596281,LOC102310619 other upstream 1405344 12894120 ~ 12895452 (+)
AMCG00005984 timm13,LOC106573564,LOC107731338,LOC107587003,LOC106613710,LOC107593051 other upstream 1586225 12711778 ~ 12714571 (+)
AMCG00006009 tax1bp3,LOC106573550,LOC107685157,LOC106613700 other downstream 70219 14375995 ~ 14383580 (+)
AMCG00006022 NA other downstream 114606 14420382 ~ 14424746 (+)
AMCG00006034 vmac,LOC106573562 other downstream 346423 14652199 ~ 14659497 (+)
AMCG00006092 rps28 other downstream 797680 15103456 ~ 15105567 (+)
G155932 NA other downstream 801433 15107209 ~ 15107734 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01019805_00001456_00004119 TPM2 coding CI01019805 null 760 ~ 4128 (+)