G22415 (alx4,LOC107593440,LOC106587508,LOC107688160,LOC107750553,LOC107683603,LOC107754690)


Basic Information

Item Value
gene id G22415
gene name alx4,LOC107593440,LOC106587508,LOC107688160,LOC107750553,LOC107683603,LOC107754690
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030123.1
NCBI id CM030123.1
chromosome length 53548854
location 9624566 ~ 9624878 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU28102
CTGCACGCGGGCCTCTGTCAGGTCGGTGCGCAGGGCCAGCTGCTCGCGGGCATACACGTCTGGGTAGTGTGTCTTCTGGAACACCTTCTCCAGTTCTTCCAGTTGGTAGCTGGTGAAGGTGGTGCGGTTGCGCCTCTTCTTGCCTTTGTTGCTCTCGCCCTCGGCCTTGTCTAGGGGACTGGCGAGCTCGGAGCCTGGCCGCTCCTGGGGCCCCTTCACCCCTGCCTCCTTCACGCTGAGGTAGCTGCCGTCCATCCCTGCAGGGTCAGCGCTCGGGGGCAACTCGGAGTCTGTCAGTCCAGGGCTGTCTTTG

Function

symbol description
alx4 Enables sequence-specific double-stranded DNA binding activity. Involved in hair follicle development. Located in nucleoplasm. Implicated in craniosynostosis and parietal foramina.

NR:

description
homeobox protein aristaless-like 4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU28102 True 313 lncRNA 0.64 1 9624566 9624878

Neighbor

gene id symbol gene type direction distance location
AMCG00007269 NA coding downstream 113227 9495648 ~ 9511339 (-)
AMCG00007266 nat10 coding downstream 136878 9473893 ~ 9487688 (-)
AMCG00007268 NA coding downstream 197784 9411640 ~ 9426782 (-)
AMCG00007259 NA coding downstream 240879 9350044 ~ 9383687 (-)
AMCG00007262 rps13,LOC107586033 coding downstream 285411 9335727 ~ 9339155 (-)
AMCG00007272 ext2 coding upstream 19557 9644435 ~ 9683079 (-)
AMCG00007271 kcnj11,LOC106561047 coding upstream 61228 9686106 ~ 9687263 (-)
AMCG00007273 abcc8 coding upstream 65395 9690273 ~ 9750042 (-)
AMCG00007274 ush1c,LOC106561052 coding upstream 130046 9754924 ~ 9792167 (-)
AMCG00007283 tnnt3b,LOC105906454,LOC107703302,LOC107742575 coding upstream 314313 9939191 ~ 9943224 (-)
G22414 LOC106562319,LOC107683603,LOC107754690,LOC106587508,LOC107750553,LOC107688160 non-coding downstream 25412 9598692 ~ 9599154 (-)
G22393 NA non-coding downstream 187297 9417768 ~ 9437269 (-)
G22305 NA non-coding downstream 439737 9181018 ~ 9184829 (-)
G22298 NA non-coding downstream 643748 8976117 ~ 8980818 (-)
G22249 NA non-coding downstream 933815 8690198 ~ 8690751 (-)
G22416 alx4,alx4a,LOC107754690,LOC107593440,LOC107683603,LOC103356993 non-coding upstream 8931 9633809 ~ 9640829 (-)
G22505 NA non-coding upstream 408250 10033128 ~ 10044315 (-)
G22513 NA non-coding upstream 460882 10085760 ~ 10086383 (-)
G22619 api5 non-coding upstream 748861 10373739 ~ 10375219 (-)
G22660 NA non-coding upstream 922118 10546996 ~ 10578902 (-)
AMCG00007267 NA other downstream 161229 9457488 ~ 9463337 (-)
G22200 NA other downstream 1228342 8393196 ~ 8396224 (-)
G21942 NA other downstream 2117691 7499447 ~ 7506875 (-)
AMCG00007201 NA other downstream 2282225 7324424 ~ 7342341 (-)
AMCG00007173 madd other downstream 3570502 6007640 ~ 6054064 (-)
AMCG00007282 NA other upstream 335184 9960062 ~ 10001165 (-)
AMCG00007299 NA other upstream 527602 10152480 ~ 10246746 (-)
AMCG00007289 bet1l,LOC107740886 other upstream 562430 10187308 ~ 10190204 (-)
AMCG00007298 NA other upstream 640167 10265045 ~ 10272695 (-)
G22838 NA other upstream 3726639 13351517 ~ 13352073 (-)

Expression


Co-expression Network