G81116


Basic Information

Item Value
gene id G81116
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030129.1
NCBI id CM030129.1
chromosome length 41163702
location 32467875 ~ 32468256 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU101190
atcagccataacattatgagcactgacaggtgaagtgaataacactgataatcttgttatcatggcatctgtcagtgagtgggatatattaggcagcaagtgaacattttgtcctcaaatttgatgtgttagaagcaggaaaaatgggcagcgtaaggatctgagcgactttgacaagggccaaattgtgatggctagacgactgggtcagagcatctccaaaactgcagctcttgtggggtgttcccggtctgcagtggtcagtacctatcaaaagtggtccaaggaaagaaaagcggtgaaccggcgacagggtcatgggcggccaaggctcattgatgcacgtggggagcgaaggcgggcccgtgtggtccgatccaac

Function

NR:

description
PREDICTED: carbohydrate sulfotransferase 8-like

GO:

id name namespace
GO:0006091 generation of precursor metabolites and energy biological_process
GO:0006099 tricarboxylic acid cycle biological_process
GO:0006101 citrate metabolic process biological_process
GO:0009060 aerobic respiration biological_process
GO:0015980 energy derivation by oxidation of organic compounds biological_process
GO:0045333 cellular respiration biological_process
GO:0044429 obsolete mitochondrial part cellular_component
GO:0044444 obsolete cytoplasmic part cellular_component
GO:0031966 mitochondrial membrane cellular_component
GO:0005739 mitochondrion cellular_component
GO:0005740 mitochondrial envelope cellular_component

KEGG:

id description
ko00020 Citrate cycle (TCA cycle)

RNA

RNA id representative length rna type GC content exon number start site end site
TU101190 True 382 lncRNA 0.50 1 32467875 32468256

Neighbor

gene id symbol gene type direction distance location
AMCG00010491 NA coding downstream 153975 32311451 ~ 32313900 (-)
AMCG00010490 NA coding downstream 406718 32005161 ~ 32061157 (-)
AMCG00010488 NA coding downstream 519602 31947650 ~ 31948273 (-)
AMCG00010489 NA coding downstream 520494 31486416 ~ 31947381 (-)
AMCG00010481 NA coding downstream 1357671 31107676 ~ 31110204 (-)
AMCG00010498 reep5,LOC108246451,LOC107740782 coding upstream 28178 32496434 ~ 32508301 (-)
AMCG00010499 mcc,LOC106565572 coding upstream 66118 32534374 ~ 32578778 (-)
AMCG00010500 NA coding upstream 171151 32639407 ~ 32645904 (-)
AMCG00010504 NA coding upstream 435351 32903607 ~ 32936398 (-)
AMCG00010506 pggt1b coding upstream 469454 32937710 ~ 32949637 (-)
G80901 NA non-coding downstream 1730481 30734784 ~ 30737394 (-)
G80862 NA non-coding downstream 1863125 30604514 ~ 30604750 (-)
G80786 NA non-coding downstream 2082628 30346465 ~ 30385247 (-)
G80778 NA non-coding downstream 2196210 30224925 ~ 30271665 (-)
G80777 NA non-coding downstream 2208567 30253795 ~ 30259308 (-)
G81138 NA non-coding upstream 57422 32525678 ~ 32530211 (-)
G81157 NA non-coding upstream 91755 32560011 ~ 32591606 (-)
G81258 NA non-coding upstream 685896 33154152 ~ 33155346 (-)
G81287 NA non-coding upstream 1001721 33469977 ~ 33517151 (-)
G81340 NA non-coding upstream 1395641 33863897 ~ 33864171 (-)
AMCG00010487 ppip5k2 other downstream 470181 31954370 ~ 31997694 (-)
AMCG00010478 znf367,LOC107568105,LOC107704585 other downstream 1387553 31072452 ~ 31080322 (-)
AMCG00010458 LOC107396140 other downstream 1947494 30510970 ~ 30520381 (-)
AMCG00010442 LOC107672760,LOC107738293,LOC107592320 other downstream 2506551 29952690 ~ 29961324 (-)
AMCG00010371 NA other downstream 6041217 26412210 ~ 26426658 (-)
AMCG00010509 fem1c,LOC106580179 other upstream 525031 32993287 ~ 32999999 (-)
AMCG00010532 ppic,LOC107713556 other upstream 1630090 34098346 ~ 34104672 (-)
G81716 NA other upstream 3246695 35714951 ~ 35716672 (-)
AMCG00010597 ercc8 other upstream 4159645 36627901 ~ 36641693 (-)
AMCG00010602 NA other upstream 4209441 36677697 ~ 36683818 (-)

Expression


Co-expression Network