AMCG00015874 (stox2,stox2a,LOC107550915,LOC107684970,LOC107671062,LOC107559650,LOC107748824,LOC106610000)


Basic Information

Item Value
gene id AMCG00015874
gene name stox2,stox2a,LOC107550915,LOC107684970,LOC107671062,LOC107559650,LOC107748824,LOC106610000
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030132.1
NCBI id CM030132.1
chromosome length 32980562
location 26473854 ~ 26474183 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00015874
ATGGACAAATTTCTGCAGATCGCCCCGCACTCGCTGGCCATCGTGCTGTCCCGCACCGGCGCCGGGGAAGAGCCCGCAGCGGCCGGCCAGCTCCAGCACCACCACACGGGCTACGAGATCTTCGCCGACTTCAAGGCGGAGAACATGCAGCATTTCTGGAATAAGAGGGTCACCGACGCCATCTCGGAGACCTTCTTCCTGGGCTGGATCGACGAGCACGTCCTGCTGATCCAGGGCAAGGAGGACCACCTGGAGGTGCTGAGGGAGGGCTGGATGCGCAGGTCCCTGAAGCCGCCCCGGGGCTTCGAGATCAAGTACCTGGGTCAGTAG

Function

symbol description
stox2a Predicted to act upstream of or within regulation of transcription by RNA polymerase II. Orthologous to human STOX2 (storkhead box 2).
stox2 Involved in embryo development and maternal placenta development.

NR:

description
PREDICTED: storkhead-box protein 2 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00015874 True 330 mRNA 0.64 1 26473854 26474183

Neighbor

gene id symbol gene type direction distance location
AMCG00015871 NA coding downstream 88466 26367724 ~ 26385388 (-)
AMCG00015865 NA coding downstream 233129 26240273 ~ 26240725 (-)
AMCG00015864 NA coding downstream 233718 26235005 ~ 26240136 (-)
AMCG00015863 helt,LOC102781250 coding downstream 296917 26173669 ~ 26176937 (-)
AMCG00015857 slc25a4,LOC102781543,LOC107562743 coding downstream 339998 26131082 ~ 26133856 (-)
AMCG00015879 NA coding upstream 2541 26476724 ~ 26494504 (-)
AMCG00015880 trappc11,LOC107559294,LOC107731725,LOC106909384 coding upstream 21181 26495364 ~ 26519876 (-)
AMCG00015881 ing1,LOC107671086 coding upstream 90138 26564321 ~ 26569444 (-)
AMCG00015878 NA coding upstream 116135 26590318 ~ 26637382 (-)
AMCG00015883 tenm3,LOC107737101 coding upstream 297181 26771364 ~ 26790445 (-)
G101249 NA non-coding downstream 209539 26264076 ~ 26264315 (-)
G101242 NA non-coding downstream 220608 26251123 ~ 26253246 (-)
G101181 NA non-coding downstream 428512 25995843 ~ 26045342 (-)
G101115 NA non-coding downstream 898933 25574403 ~ 25574921 (-)
G101103 LOC107702333,LOC107746031 non-coding downstream 1071357 25399982 ~ 25402497 (-)
G101309 NA non-coding upstream 49476 26523659 ~ 26525730 (-)
G101317 NA non-coding upstream 99883 26574066 ~ 26574287 (-)
G101318 NA non-coding upstream 100202 26574385 ~ 26575210 (-)
G101369 NA non-coding upstream 294024 26768207 ~ 26770268 (-)
G101388 NA non-coding upstream 1195249 27669432 ~ 27669755 (-)
G101067 NA other downstream 1472964 24992953 ~ 25000890 (-)
AMCG00015825 LOC106569940,LOC107700648,LOC107717728,LOC108274877,LOC107565247 other downstream 2727151 23743790 ~ 23746703 (-)
AMCG00015800 NA other downstream 3771605 22680694 ~ 22702249 (-)
AMCG00015761 herc3 other downstream 6194210 20227367 ~ 20279644 (-)
AMCG00015752 NA other downstream 6492297 19974956 ~ 19981557 (-)
AMCG00015892 spcs3,LOC106602378 other upstream 1512572 27986755 ~ 27997677 (-)
AMCG00015891 wdr17 other upstream 1567380 28041563 ~ 28069876 (-)
G101456 NA other upstream 1687654 28161837 ~ 28257732 (-)
G101540 NA other upstream 2630046 29104229 ~ 29106160 (-)
AMCG00015936 med28,LOC107702388 other upstream 3689090 30163273 ~ 30168350 (-)

Expression


Co-expression Network