G100261 (rnf150,LOC107703843,LOC107746087)


Basic Information

Item Value
gene id G100261
gene name rnf150,LOC107703843,LOC107746087
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030132.1
NCBI id CM030132.1
chromosome length 32980562
location 19801976 ~ 19802225 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU125256
CTGGTTTCGGTCGCGTGCGTTGGCGTATCTGAACCTCTGGATGTAGTAGAAGACCAGCCAGGCCAGGGAGATGATCATTAGCACTATGAAGGAGATGGATACGAAGACCACTGATGTCCGGCTGACGTATTTCTGCAGATTGCGTGTCCCGATGGTGATGTACATCATCACAGTGACGTTCTTTTCCAGCAGAGACACAATCTCCCGTCCCTTGGGCTCTGGGATCATGATGGCCACAATTTCACCTGTT

Function

symbol description
rnf150 Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in ubiquitin-dependent protein catabolic process. Predicted to be integral component of membrane. Predicted to be active in cytoplasm.

NR:

description
PREDICTED: RING finger protein 150

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU125256 True 250 lncRNA 0.51 1 19801976 19802225

Neighbor

gene id symbol gene type direction distance location
AMCG00015743 znf330,zn330,LOC107746098 coding downstream 41821 19747264 ~ 19760155 (-)
AMCG00015740 NA coding downstream 542854 19239310 ~ 19259122 (-)
AMCG00015739 NA coding downstream 647664 19132809 ~ 19154312 (-)
AMCG00015738 smarca5,LOC107703846 coding downstream 676494 19110816 ~ 19125482 (-)
AMCG00015735 LOC106602344 coding downstream 882369 18876488 ~ 18919607 (-)
AMCG00015749 NA coding upstream 105414 19907639 ~ 19910150 (-)
AMCG00015750 NA coding upstream 125157 19927382 ~ 19928527 (-)
AMCG00015753 LOC108275807,LOC108441536 coding upstream 130060 19932285 ~ 19945300 (-)
AMCG00015751 NA coding upstream 193944 19996169 ~ 20010622 (-)
AMCG00015755 NA coding upstream 313068 20115293 ~ 20122414 (-)
G100257 LOC104962440 non-coding downstream 61775 19721668 ~ 19740201 (-)
G100233 NA non-coding downstream 88760 19712927 ~ 19713216 (-)
G100222 NA non-coding downstream 100517 19671742 ~ 19701459 (-)
G100218 NA non-coding downstream 102147 19625060 ~ 19699829 (-)
G100185 NA non-coding downstream 669410 19132360 ~ 19132566 (-)
G100267 NA non-coding upstream 37149 19839374 ~ 19844744 (-)
G100297 NA non-coding upstream 123577 19925802 ~ 19926102 (-)
G100381 NA non-coding upstream 191015 19993240 ~ 19995630 (-)
G100385 NA non-coding upstream 293656 20095881 ~ 20100083 (-)
G100391 LOC100846954 non-coding upstream 350961 20153186 ~ 20153634 (-)
AMCG00015723 lsm6,LOC106610200 other downstream 1171311 18627605 ~ 18630665 (-)
G99939 NA other downstream 1964034 17837580 ~ 17837942 (-)
AMCG00015694 NA other downstream 3190532 16592228 ~ 16611444 (-)
AMCG00015691 NA other downstream 3266508 16524114 ~ 16535468 (-)
AMCG00015681 NA other downstream 3328799 16467299 ~ 16473177 (-)
AMCG00015752 NA other upstream 172731 19974956 ~ 19981557 (-)
AMCG00015761 herc3 other upstream 425142 20227367 ~ 20279644 (-)
AMCG00015800 NA other upstream 2878469 22680694 ~ 22702249 (-)
AMCG00015825 LOC106569940,LOC107700648,LOC107717728,LOC108274877,LOC107565247 other upstream 3941565 23743790 ~ 23746703 (-)
G101067 NA other upstream 5190728 24992953 ~ 25000890 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_021992 rnf150b coding NC_007134.7 CM002907.2 43770149 ~ 43787147 (+)
grasscarp (Ctenopharyngodon idella) CI01000302_00611936_00629359 RNF150 coding CI01000302 null 610463 ~ 629412 (+)